Ballochia rotundifolia — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Ballochia

At a glance

Occurrence records17

Data sources6

Biological traits2

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Ballochia rotundifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF17 records

DNA & barcodingNCBIsequences

01Narrative

Ballochia rotundifolia is a species of plant in the family Acanthaceae. It is endemic to Socotra. Its natural habitat is subtropical or tropical dry forests.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formshrub or tree

Habitat & environment1

Climatedesert or dry shrubland

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ballochia rotundifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW464257.1 ↗652 bpYemen

ACGT

GGAAGGATCATTGTCGAAACCNGTGAAGGCAGACCGCGAACACGTGTTTAACCTTCTCGAGGCTCCGGTGCGGGGGCGTGTCCCCCCTCC …

Ballochia rotundifolia voucher cultivated S.F. Conservatory of Flowers, San Francisco, California, USA, Daniel s.n. (CAS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type17 records

Wild obs. + sensor5

Museum / vouchered12

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	5
Kew, GB	2
Stockholm, SE	1
MAlocation not on record	1
Wlocation not on record	1
BClocation not on record	1
Edinburgh, GB	1

7 institutions · 12 of 12 vouchered records shown