Ballochia amoena — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Ballochia

At a glance

Occurrence records16

Data sources6

Biological traits3

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Ballochia amoena's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF16 records

DNA & barcodingNCBIsequences

01Narrative

Ballochia amoena is a species of plant in the family Acanthaceae. It is endemic to Yemen. Its natural habitats are subtropical or tropical dry forests and subtropical or tropical dry shrubland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formshrub

Habitat & environment1

Climatedesert or dry shrubland

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ballochia amoena has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW464259.1 ↗665 bpYemen

ACGT

GCGGAAGGATCATTGTCAAAACCTGTGAAGGCAGACCGCGAACACGTGTTTAACCTTCTCGAGGCTCCGGTGAGGGGGCGTGTCCCCCTC …

Ballochia amoena voucher Smith and Lavanos 761 (EA) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor6

Museum / vouchered10

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	3
Stockholm, SE	1
Kew, GB	1
Frankfurt am Main	1
Wlocation not on record	1
Edinburgh, GB	1
Uppsala, SE	1

7 institutions · 9 of 10 vouchered records shown · 1 without an institution code