Baliospermum solanifolium

(Burm.) Suresh · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Baliospermum

At a glance

Occurrence records119

Data sources13

Biological traits14

DNA specimens8

eDNA detections6

Sources13 archives

Databases and archives Baliospermum solanifolium's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS12 compounds

Occurrence & distributionGBIF119 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB · TreeOfSex2n = 28

01Narrative

Baliospermum montanum (Sanskrit : हस्तिदंती Hastidanti), commonly known as red physic nut, wild castor, wild croton and wild sultan seed, is a plant in the family Euphorbiaceae. Baliospermum montanum is a stout undershrub with numerous flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height2 m

Plant height max0.9 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinessvariable

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition12 compounds

Compounds documented for Baliospermum solanifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

2-arylbenzofurans6

Furanoid lignans2

Neolignans2

Hydroxy fatty acids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Larreatricin	present	NPASS
2-(2,4-Dihydroxyphenyl)-5-(E)-Propenylbenzofuran	present	NPASS
2-(2-Hydroxy-4-methoxyphenyl)-5-(3-hydroxypropyl)benzofuran	present	NPASS
2-(4-hydroxyphenyl)-5-(E)-propenylbenzofuran	present	NPASS
2-(4-methoxyphenyl)-5-[(E)-prop-1-enyl]-1-benzofuran	present	NPASS
4-(5-(3-Hydroxypropyl)-1-Benzofuran-2-Yl)-3-Methoxyphenol	present	NPASS
4-[(2S,3R)-3-(hydroxymethyl)-5-[(E)-prop-1-enyl]-2,3-dihydro-1-benzofuran-2-yl]phenol	present	NPASS
Conocarpan	present	NPASS
Eupomatenoid 6	present	NPASS
Meso-3,3'-Didemethoxynectandrin B	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Baliospermum solanifolium has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP704462.1 ↗430 bpSri Lanka · 2023

ACGT

CTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTCGGCCGAGGGCACGTCTGCCTGG …

Baliospermum solanifolium voucher 44-003-02 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Baliospermum solanifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records20–442n range28median28mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Perry, B.A. 1943

CCDB · book-fedorov — Perry B. A. 1943

CCDB · book-atlas-flowering-plants — Perry 1943

2n 201×TreeOfSex · plant

TreeOfSex · plant — Goldblatt1979 ↗

2n 441×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Sarkar, A.K., Datta, N. et al. 1976

n 102×CCDB · book-ipcn73-74 · TreeOfSex · plant

CCDB · book-ipcn73-74 — MEHRA, P.N., & A.S. HANS. 1972. Comparison of diploid and natural polyploid hardwoods. J. Indian Bot. soc. 51: 319-325.

TreeOfSex · plant — Goldblatt1979 ↗

n 222×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, R. Mallick & U. Chatterjee. 1976a. In IOPB chromosome number reports LIV. Taxon 25: 631–649.

CCDB · book-ipcn75-78 — Sarkar et al. l 976a

08Occurrence & distribution

Record type119 records

Wild obs. + sensor23

Museum / vouchered96

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 3≤1 km 4≤10 km 3

10 georeferenced · 13 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 5≤10 km 7

14 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	13
National Institute of Biological Resourceslocation not on record	1
Ann Arbor, US	1
Philadelphia, US	1
University of Stellenboschlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1

6 institutions · 18 of 96 vouchered records shown · 77 without an institution code

09Environmental DNA6 detections

Where the DNA of Baliospermum solanifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.3 °C 19.5–27.5

Seasonal swing summer↔winter8.20 °C

Max temp (day)30.0 °C 25.2–30.8

Min temp (night)24.3 °C 13.9–24.3

Precipitation240 mm/mo 57.4–305

Air humidity63.3 % 53.7–66.8

Moisture balance101 mm/mo -29.7–154

Vapour deficit1,195 Pa 1,018–1,311

Wind speed1.40 m/s 1.30–3.50

Cloud cover14.1 % 13.8–28.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)