Balduina uniflora

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Balduina

At a glance

Occurrence records814

Data sources11

Biological traits8

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Balduina uniflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility814 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF814 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 72

01Narrative

Balduina uniflora (commonly called oneflower honeycombhead, savannah honeycombhead or oneflower balduina) is a North American species of plants in the sunflower family. It is native to the southeastern United States (Louisiana, Florida, Georgia, Alabama, Mississippi, South Carolina, North Carolina).Biota of North America Program 2014 county distribution map It is the type species of Genus Balduina. Balduina uniflora is a perennial herb with branching stems. Each plant has 1-4 flower heads, each with 8-22 yellow ray florets and 50-180 orange or yellow disc florets. The species grows in wet pinelands and savannahs,Flora of North America, Balduina uniflora Nuttall, Gen. N. Amer. Pl. 2: 175. 1818. as well as wetland areas and on the edges of bogs and tends to occur in wet drainage ditches and on roadsides.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition26 compounds

Compounds documented for Balduina uniflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavan-3-ols15

Proanthocyanins8

Pseudoguaiane sesquiterpenoids1

Flavan-3-ols $ Proanthocyanins1

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R)-5,7-Diacetoxy-2-(3,4,5-Triacetoxyphenyl)-3,4-Dihydro-2H-Chromen-3-Yl 3,4,5-Triacetoxybenzoate	present	NPASS
(2R,3R)-6-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3R)-8-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3R)-8-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3S)-6-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3S)-6-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(4alpha->8)-bis-4'-O-methylgallocatechin	present	NPASS
4'-O-Methyl-Gallocatechin	present	NPASS
4a,8-Dimethyl-3-methylidene-2,5-dioxo-2,3,3a,4,4a,5,7a,8,9,9a-decahydroazuleno(6,5-b)furan-4-yl acetate	present	LOTUS
[(2R,3R)-5,7-diacetyloxy-2-(3,4,5-triacetyloxyphenyl)-3,4-dihydro-2H-chromen-3-yl] 4-acetyloxy-3,5-dimethoxybenzoate	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Balduina uniflora has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes5

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF229270.1 ↗644 bp

ACGT

TCGAAACCTGCATAGCAGAGCAACCTGGAACAAGTACTTACAATGTGGCTTTTTGGGCTTTAAGCTTTTGGTTTGATACCCGGGAAGCCT …

Balduina uniflora internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Balduina uniflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidydiploid inferred

Chromosome records72–722n range72median72mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 722×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Turner, Ellison, King 1961

n 362×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — PARKER, E. S. & S. B. JONES. 1975. A systematic study of the genus Balduina (Compositae, Heliantheae). Brittonia 27: 355–361.

CCDB · book-ipcn67-71 — JONES, S.B. Jr. 1968. Chromosome numbers in southeastern United States Compositae I. Bull. Torrey Bot. Club 95: 393-395.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type814 records

Wild obs. + sensor492

Museum / vouchered322

Range

Area of Occupancy AOO2 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 244≤1 km 33≤10 km 17>10 km 121

415 georeferenced · 77 without coordinates

Open the mapobservation + sensor492

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 34≤1 km 33≤10 km 49>10 km 39

155 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence322

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	40
Jena Microbial Resource Collectionlocation not on record	34
Jackson, US	29
Tampa, US	20
University of Southern Mississippilocation not on record	17
Valdosta State Universitylocation not on record	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	16
Bangkok, TH	14
Mississippi State, US	14
Bronx, US	12
Wuzhou, CN	12
Miami, US	11
University of Stellenboschlocation not on record	10
GAlocation not on record	9
US	9
Chongqing Museumlocation not on record	8
Tall Timbers Research Stationlocation not on record	7
Knoxville, US	6
AUAlocation not on record	5
Bloomington, US	4
Asheville, US	3
Tuscaloosa, US	3
Saint Louis, US	2
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	2
James F. Matthews Center for Biodiversity Studieslocation not on record	2
Durham, US	1
EL PASO, US	1
Long Beach, US	1
Weymouth Woods Sandhills Nature Preservelocation not on record	1
Moscow, US	1
Norfolk, US	1
Dover, US	1
Due West, US	1
San Luis Obispo, US	1
Oskarshamn, SE	1
Flagstaff, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Appalachian State Universitylocation not on record	1
San Angelo, US	1

39 institutions · 319 of 322 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Balduina uniflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)