Balanops balansae — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Balanopaceae/Balanops

At a glance

Occurrence records24

Data sources7

Biological traits10

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Balanops balansae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF24 records

DNA & barcodingNCBIsequences

01Narrative

Balanops balansae is a species of plant in the Balanopaceae family. It is endemic to New Caledonia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTrain forest

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Balanops balansae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN504796.1 ↗160 930 bpNew Caledonia · 2006

ACGT

TAATTAACTTAATTATTTTATATATATATAGATATGTATTTTATGGATTTTTTTTTATTCGTTTTAGATTTAGTGGATTAGTCTATTATC …

Balanops balansae voucher Gordon McPherson - 19374 plastid, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2

plant barcode

08Occurrence & distribution

Record type24 records

Wild obs. + sensor4

Museum / vouchered20

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	9
University of Stellenboschlocation not on record	2
Kew, GB	1
Saint Louis, US	1
South Kensington, GB	1
Monastir, TN	1

6 institutions · 15 of 20 vouchered records shown · 5 without an institution code