Balanites maughamii

Sprague · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Zygophyllales/Zygophyllaceae/Balanites

At a glance

Occurrence records182

Data sources8

Biological traits21

DNA specimens8

eDNA detections5

Sources8 archives

Databases and archives Balanites maughamii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF182 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Balanites maughamii is een plantensoort uit het geslacht Balanites, behorend tot de familie Zygophyllaceae. Het is een bladverliezende of semi bladverliezende boom of struik die tot 20 meter hoog kan worden. De stam is recht en heeft een gladde schors met een geelbruine, gevlekte of grijze kleur. De bladeren zijn spiraalvormig gerangschikt en zijn meestal asymmetrisch, elliptisch tot breed ovaal van vorm. De vruchten zijn 4 tot 8 centimeter lang en kleuren bij rijping roodbruin. De vruchtenschil is stevig maar dun. De soort staat op de Rode Lijst van de IUCN geklasseerd als 'niet bedreigd'. De soort komt voor in tropisch Oost-Afrika, van Zuid-Tanzania tot in Zuid-Afrika. Hij groeit daar in droge open bossen, vaak langs rivieren of in de buurt van bronnen en rondom pannen. De soort geeft meestal de voorkeur aan bodems met zand- of kleileem. De vruchten zijn eetbaar en hebben een aangename zoete geur en smaak, die na verloop van tijd bitter wordt. Uit het zaad wordt een heldere gele olie verkregen die smaak- en geurloos is. Deze olie is eetbaar en wordt gebruikt bij het koken. Verder wordt de olie als massageolie gebruikt of als brandstof in fakkels. Delen van de boom worden gebruikt in magie en traditionele geneeskunde. De wortels en schors worden veel gebruikt in laxerende medicijnen. Bomen met grote rechte stammen kunnen waardevol hardhout opleveren.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height17.5 m

⚠ sources differ — GIFT: 17.5 m · TRY: 20 m

Plant height max20 m

Plant height min2 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTevergreen forest, coastal thicket, groundwater forest

Woodinesswoody

Physiology & chemistry4

Leaf n39.22 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.88 mm²/mg

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Balanites maughamii has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences9

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH699440.1 ↗366 bp

ACGT

TCTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCA …

Balanites maughamii isolate Zygo271 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type182 records

Wild obs. + sensor154

Museum / vouchered28

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 11≤1 km 4>10 km 132

147 georeferenced · 7 without coordinates

Open the mapobservation + sensor154

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigação Científica Tropicallocation not on record	10
Kew, GB	4
Bronx, US	2
Pretoria, ZA	2
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	2
University of Johannesburglocation not on record	1
MeiseBGlocation not on record	1

7 institutions · 22 of 28 vouchered records shown · 6 without an institution code

09Environmental DNA5 detections

Where the DNA of Balanites maughamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 19.6–21.7

Seasonal swing summer↔winter8.80 °C

Max temp (day)25.7 °C 25.6–27.6

Min temp (night)14.3 °C 13.8–15.5

Precipitation18.1 mm/mo 14.2–51.0

Air humidity54.9 % 53.9–56.0

Moisture balance-83.1 mm/mo -101–-70.5

Vapour deficit1,078 Pa 1,005–1,200

Wind speed2.80 m/s 2.70–3.20

Cloud cover16.8 % 14.8–24.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)