Bagrichthys obscurus — The Life Data

Animalia/Chordata/Siluriformes/Bagridae/Bagrichthys

At a glance

Occurrence records21

Data sources7

Biological traits4

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Bagrichthys obscurus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF21 records

DNA & barcodingBOLD3 specimens

01Narrative

Bagrichthys obscurus is a species of bagrid catfish which is found in Cambodia, Laos, Thailand and Vietnam where it is found in the Chao Phraya, Bang Pakong and Mekong drainages. It grows to a length of 24.9 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length24.91 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability20.39

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bagrichthys obscurus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTTTACTTAGTATTTGGTGCCTGGGCCGGAATAGTTGGTACAGCCCTTAGCCTATTAATTCGGGCAGAGCTAGCCCAACCCGGAGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bagrichthys micranodussame genus6.3%Bagrichthys majusculussame genus6.6%Bagrichthys hypselopterussame genus6.9%Bagroides melapterussame family7.8%Leiocassis micropogonsame family8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type21 records

Museum / vouchered21

Range

Area of Occupancy AOO64 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence21

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	10
Washington, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
CASlocation not on record	2

4 institutions · 21 of 21 vouchered records shown