Babakina anadoni

(Ortea, 1979) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Babakinidae/Babakina

At a glance

Occurrence records181

Data sources7

Biological traits3

DNA specimens5

eDNA detections6

Sources7 archives

Databases and archives Babakina anadoni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility169 records↗

OBISOcean Biodiversity Information System12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS181 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD5 specimens

01Narrative

Babakina anadoni è un mollusco nudibranchio della famiglia Babakinidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length1 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Babakina anadoni has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P668 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

44Cmostly conserved

53Amostly conserved

69Tmostly conserved

92Tmostly conserved

131Gmostly conserved

137Tmostly conserved

173Cmostly conserved

200Tmostly conserved

245Tmostly conserved

272Gmostly conserved

275Tmostly conserved

332Gmostly conserved

353Tmostly conserved

356Cmostly conserved

362Tmostly conserved

395Cmostly conserved

416Cmostly conserved

428Amostly conserved

438Tmostly conserved

440Amostly conserved

443Amostly conserved

485Tmostly conserved

521Gmostly conserved

530Cvariable

533Tmostly conserved

539Cmostly conserved

552Tmostly conserved

567Cmostly conserved

588Cmostly conserved

590Cmostly conserved

623Cmostly conserved

629Amostly conserved

632Cmostly conserved

668Tmostly conserved

AAGATATTGGTACTTTGTATGTTCTTTTAGGTATGTGATGTGGCTTAGCTGGAACCGGGCTTAGATTATTAATTCGATTTGAGCTGGGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes3

BINs2

Most divergent pair4.6%

S.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Babakina indopacificasame genus7.9%Coryphella nobilissame order15.7%Coryphella lineatasame order16.1%Coryphella alexanderisame order16.2%Protaeolidiella atrasame order16.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type181 records

Wild obs. + sensor151

Museum / vouchered29

Other1

Range

Area of Occupancy AOO212 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 15 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 87≤1 km 35≤10 km 7>10 km 2

131 georeferenced · 20 without coordinates

Open the mapobservation + sensor151

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	11
Museo Nacional de Ciencias Naturales (CSIC)location not on record	6
IBUFRJlocation not on record	1

3 institutions · 18 of 29 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Babakina anadoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 15.2–22.8

Seasonal swing summer↔winter4.90 °C

Max temp (day)20.1 °C 19.6–26.4

Min temp (night)18.2 °C 9.00–20.0

Precipitation37.7 mm/mo 33.4–116

Air humidity60.0 % 52.9–63.9

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa 830–1,073

Wind speed2.00 m/s

Cloud cover38.3 % 34.6–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)