Azteca coeruleipennis

Emery, 1893 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Azteca

At a glance

Occurrence records88

Data sources7

Biological traits0

DNA specimens9

eDNA detections15

Sources7 archives

Databases and archives Azteca coeruleipennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD9 specimens

01Narrative

Azteca coeruleipennis is a species of ant in the genus Azteca. Described by Emery in 1893, the species is endemic to several countries in North America and Central America.Emery, C. 1893. Studio monografico sul genere Azteca Forel. Mem. R. Accad. Sci. Ist. Bologna (5)3:119-152

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Azteca coeruleipennis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

3Cmostly conserved

28Gmostly conserved

30Amostly conserved

48Amostly conserved

54Tmostly conserved

73Tmostly conserved

75Gmostly conserved

87Gvariable

91Cmostly conserved

99Cmostly conserved

102Tmostly conserved

129Tmostly conserved

130Amostly conserved

180Cmostly conserved

204Amostly conserved

216Amostly conserved

234Cmostly conserved

237Amostly conserved

258Cmostly conserved

270Tmostly conserved

288Amostly conserved

315Amostly conserved

321Tmostly conserved

324Amostly conserved

345Tmostly conserved

372Tmostly conserved

375Amostly conserved

390Amostly conserved

393Cmostly conserved

417Gmostly conserved

495Cmostly conserved

502Amostly conserved

555Tmostly conserved

564Cmostly conserved

567Cmostly conserved

573Amostly conserved

580Cmostly conserved

595Cmostly conserved

609Cmostly conserved

624Amostly conserved

627Amostly conserved

630Gmostly conserved

645Cvariable

ATCCTTTACTTTATTTTTGCAATTTGAGCAGGAATAATTGGATCTTCAATAAGTATAATTATTCGACTTGAATTGGGTACTTGTGGGTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes3

BINs2

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Technomyrmex innocenssame family16.2%Technomyrmex fisherisame family16.3%Pachycondyla impressasame family16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type88 records

Museum / vouchered88

Range

Area of Occupancy AOO156 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1>10 km 1

3 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence88

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	78
National Biodiversity Institute, Costa Ricalocation not on record	3
Universidad del Vallelocation not on record	1
Cambridge, US	1
San Francisco, US	1
Durango, MX	1

6 institutions · 85 of 88 vouchered records shown · 3 without an institution code

09Environmental DNA15 detections

Where the DNA of Azteca coeruleipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 22.9–25.2

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.9 °C 26.0–30.2

Min temp (night)20.2 °C 19.9–21.5

Precipitation76.9 mm/mo 25.8–242

Air humidity65.3 % 60.8–70.1

Moisture balance-76.9 mm/mo -158–90.4

Vapour deficit963 Pa 865–1,229

Wind speed5.70 m/s 2.30–7.40

Cloud cover18.9 % 13.6–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)