Azteca alfari

Emery, 1893 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Azteca

At a glance

Occurrence records402

Data sources7

Biological traits0

DNA specimens11

eDNA detections1

Sources7 archives

Databases and archives Azteca alfari's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility402 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF402 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD11 specimens

01Narrative

Azteca alfari is a species of ant in the genus Azteca. Described by Carlo Emery in 1893, the species is widespread in Mexico, Central and South America.Emery, C. 1893. Studio monografico sul genere Azteca Forel. Mem. R. Accad. Sci. Ist. Bologna (5)3:119-152 This ant has a mutualistic relationship with a Cecropia tree. The specific name alfari honours a Costa Rican zoologist Anastasio Alfaro.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Azteca alfari has left across the world's sequence archives.

At a glance

DNA specimens11

BINs5

Marker genes2

eDNA detections1

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Where individuals differ — all 133 variable positions, in barcode order

1Tvariable

4Amostly conserved

5Tmostly conserved

7Amostly conserved

14Amostly conserved

15Tmostly conserved

19Tvariable

22Tmostly conserved

25Tvariable

28Amostly conserved

31Tmostly conserved

34Amostly conserved

46Amostly conserved

49Tmostly conserved

62Avariable

67Amostly conserved

68Tmostly conserved

74Tmostly conserved

79Amostly conserved

85Tmostly conserved

89Tmostly conserved

91Amostly conserved

92Tmostly conserved

94Amostly conserved

100Amostly conserved

106Tmostly conserved

112Tmostly conserved

118Cmostly conserved

124Tmostly conserved

127Cvariable

130Amostly conserved

133Amostly conserved

136Cvariable

139Amostly conserved

154Cmostly conserved

157Cvariable

163Amostly conserved

169Amostly conserved

178Tvariable

181Avariable

184Tvariable

193Tmostly conserved

202Tmostly conserved

205Cvariable

208Amostly conserved

212Tmostly conserved

220Tvariable

223Tvariable

232Amostly conserved

235Cvariable

238Amostly conserved

241Tvariable

250Cvariable

263Tmostly conserved

265Amostly conserved

266Cvariable

268Amostly conserved

271Cvariable

277Amostly conserved

280Cmostly conserved

283Tmostly conserved

286Tmostly conserved

295Tmostly conserved

301Tvariable

316Amostly conserved

325Tmostly conserved

334Amostly conserved

337Cmostly conserved

340Cvariable

343Cvariable

346Tmostly conserved

349Cmostly conserved

352Tmostly conserved

355Tmostly conserved

358Cmostly conserved

361Cvariable

367Tmostly conserved

370Tmostly conserved

373Cmostly conserved

376Cmostly conserved

379Tmostly conserved

385Tvariable

386Tmostly conserved

388Amostly conserved

394Tmostly conserved

397Cvariable

400Amostly conserved

401Tmostly conserved

403Amostly conserved

412Amostly conserved

415Amostly conserved

433Gvariable

448Tmostly conserved

454Amostly conserved

457Cmostly conserved

458Tmostly conserved

463Tvariable

469Cmostly conserved

481Cmostly conserved

482Avariable

484Cmostly conserved

485Tmostly conserved

490Tmostly conserved

496Cmostly conserved

499Cvariable

508Amostly conserved

514Amostly conserved

526Amostly conserved

529Avariable

539Cmostly conserved

541Tmostly conserved

544Tmostly conserved

550Tvariable

559Amostly conserved

562Cvariable

571Cmostly conserved

574Cvariable

578Cmostly conserved

580Tmostly conserved

581Cmostly conserved

+13 more variable positions not shown

TATATTATATTTTATTTTTGCTATTTGAGCTGGAATAATTGGATCATCTATAAGAATAATTATTCGATTAGAATTAGGAACTTGTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.8%

Haplotypes5

BINs4

Most divergent pair18.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Azteca foreliisame genus4.9%Azteca pittierisame genus12.8%Azteca beltiisame genus13.5%Linepithema neotropicumsame family16.1%Linepithema micanssame family16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S

animal barcodemarker

08Occurrence & distribution

Record type402 records

Wild obs. + sensor41

Museum / vouchered361

Origin

Native4

Range

Area of Occupancy AOO604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 5≤1 km 3≤10 km 23>10 km 3

34 georeferenced · 7 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 9≤10 km 10>10 km 5

24 georeferenced · 337 without coordinates

Open the institutions mapphysical evidence361

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	274
Tapachula, MX	46
University of Alabamalocation not on record	10
Universidad del Vallelocation not on record	8
Cambridge, US	7
Durango, MX	4
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	3
National Biodiversity Institute, Costa Ricalocation not on record	2
Lake Placid, US	1
South Kensington, GB	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1

11 institutions · 357 of 361 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Azteca alfari was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 25.4–25.4

Seasonal swing summer↔winter1.10 °C

Max temp (day)27.9 °C

Min temp (night)23.2 °C

Precipitation304 mm/mo

Air humidity70.6 %

Moisture balance152 mm/mo

Vapour deficit946 Pa

Wind speed3.10 m/s

Cloud cover43.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)