Aythya baeri

(Radde, 1863) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Anseriformes/Anatidae/Aythya

At a glance

Occurrence records3 209

Data sources10

Biological traits30

DNA specimens9

eDNA detections9

Sources10 archives

Databases and archives Aythya baeri's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 209 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Occurrence & distributionGBIF3 209 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD9 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Baer's pochard (Aythya baeri) is a diving duck found in eastern Asia. It breeds in North and Central China, formerly breeded in southeast Russia and Northeast China, migrating in winter to southern China, Vietnam, Japan, and India. Baer's pochard is a monotypic species. Its holotype was collected in middle Amur. Baer's pochard was once a common species in its range, but is now very rare. The number of mature individuals may be less than 1,000, and its population is still declining. Hunting and habitat loss are considered to be the main reason. This species has been classified as critically endangered by the IUCN, and listed as a first-class protected animal in China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology14

Beak depth14.1 mm

Beak length (culmen)44.7 mm

Beak length (nares)31 mm

Beak width20.8 mm

Body mass696 g

Body mass (female)662 g

Body mass (male)724 g

Hand-wing index48.8

Kipp's distance97.6 mm

SVL46.5 cm

Secondary length102 mm

Tail length58.2 mm

Tarsus length31.7 mm

Wing length202 mm

Life cycle & reproduction5

Age at sexual maturity363 days

Egg mass43 g

Incubation27 days

Litter size8.5

Litters per year1 /year

Diet & foraging7

Invertebrate20 %

Plant other50 %

Seed10 %

Trophic levelomnivore

Trophic nicheHerbivore aquatic

Vertebrate unknown20 %

Water below surface100 %

Habitat & environment4

HabitatWetland

Migration3.0

Primary lifestyleAquatic

Range size2 258 041 km²

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aythya baeri has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 551 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes2

BINs0

Most divergent pair0.06%

Where individuals differ — all 1 variable positions, in barcode order

273Cmostly conserved

GTGACCTTCATCAATCGATGATTATTCTCCACCAATCACAAAGACATCGGTACCCTGTATCTTATCTTCGGGGCATGAGCCGGAATAATC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_057048 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aythya baeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 144 760 485 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aythya baeri1.14 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type3 209 records

Wild obs. + sensor3 183

Museum / vouchered25

Other1

Range

Area of Occupancy AOO3 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 37≤1 km 76≤10 km 5>10 km 177

295 georeferenced · 2 888 without coordinates

Open the mapobservation + sensor3 183

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 2≤10 km 9>10 km 6

17 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	11
SNSDlocation not on record	5
New Haven, US	4
Ann Arbor, US	3
Texas Cooperative Wildlife Collectionlocation not on record	1
Chicago, US	1

6 institutions · 25 of 25 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Aythya baeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aythya baeri

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction5

Diet & foraging7

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 209 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 209 records