Avenella flexuosa
(L.) Drejer · speciesAt a glance
Occurrence records551 973
Data sources14
Biological traits130
DNA specimens54
eDNA detections469
Sources14 archives
Databases and archives Avenella flexuosa's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility551 963 records↗
OBISOcean Biodiversity Information System10 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI469 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics54 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources130 traits
Occurrence & distributionGBIF · OBIS551 973 records
Environmental DNA2 datasets · 14 countries469 detections
DNA & barcodingBOLD · NCBI54 specimens
Genome at a glanceCCDB · GoaT5.4 Gbp
01Narrative
Deschampsia flexuosa, commonly known as wavy hair-grass, is a species of bunchgrass in the grass family widely distributed in Eurasia, Africa, South America, and North America.Kew World Checklist of Selected Plant Families
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology19
Leaf length max100 mm
Leaf mass2.41 mg
Leaf size48.33 mm²
⚠ sources differ — TRY: 48.33 mm² · LEDA: 34.85 mm² · GIFT: 40.58 mm²
Plant height0.472 m
⚠ sources differ — GIFT: 0.472 m · LEDA: 0.06 m · USDA: 0.792 m · TRY: 0.1 m
Plant height generative0.333 m
Plant height max0.75 m
Plant height min0.05 m
Seed length4.0 mm
⚠ sources differ — TRY: 4.0 mm · GIFT: 2.1 mm
Seed length max2.1 mm
Seed length min2.1 mm
Seed mass0.445 mg
⚠ sources differ — TRY: 0.445 mg · LEDA: 0.24 mg · GIFT: 0.515 mg
Seed mass max0.67 mg
Seed mass min0.43 mg
Seed volume0.37 mm³
Seed volume max0.37 mm³
Seed volume min0.37 mm³
Seed width0.7 mm
Seed width max0.7 mm
Seed width min0.7 mm
Life cycle & reproduction35
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeanimal
Flower colouryellow
Flower conspicuousNo
Flowering endAug
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryShort
Lifespan years3 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number55
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 300 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Growth formherb
Growth form USDABunch
Habitat GIFTforest, meadows: dry
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min80 days
Leaf C:N ratio27.43 g/g
Leaf c452 mg/g
Leaf dry-matter content (LDMC)339 mg/g
Leaf n21.22 mg/g
Leaf p1.64 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min32 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceLow
Soil pH max6.8 pH
Soil pH min4.8 pH
Specific leaf area (SLA)14.34 mm²/mg
⚠ sources differ — TRY: 14.34 mm²/mg · LEDA: 17.3 mm²/mg · GIFT: 17.51 mm²/mg
Temperature min-38 °F
Wood density247 mg/cm³
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound668 000 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding54 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Avenella flexuosa has left across the world's sequence archives.
At a glance
DNA specimens54
Marker genes6
GenBank sequences10
eDNA detections469
Countries14
The DNA barcodea real sequence read deposited for this species
AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAAAA …
Avenella flexuosa isolate 10-G-56(14) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Avenella flexuosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 379 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Avenella flexuosa5.38 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–702n range28median28mode61records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2846×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · fl-europaea — Albers, 1972
CCDB · poland — Frey L. 1982. Cytotaxonomical studies on the genus Deschampsia P.B. sensu lato in Poland. Fragm. Flor. Geobot. 28, 117-144.
CCDB · poland — Skali?ska M., Banach-Pogan E., Wcis?o H. et al. 1957. Further studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 26, 215-246.
CCDB · book-ipcn65 — Sokolovskaya 1965
CCDB · book-ipcn65 — Tateoka 1965c
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1983. Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329–333.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Petrova, A. & K. Stoyanova. 1998. Mediterranean chromosome number reports 8 (941--960). Fl. Medit. 8: 251–262.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Albers, F. 1980. Comparative karyology of the grass subtribes Aristaveninae and Airinae (Poaceae-Avenae). Pl. Syst. Evol. 136: 137–167.
CCDB · ipcn-api-dl — Krahulcová, A. 2003. Chromosome numbers in selected monocotyledons (Czech Republic, Hungary, and Slovakia). Preslia 75: 97–113.
CCDB · ipcn-api-dl — Sorokin, S. N. 1991. Chromosome numbers in the members of the family Poaceae from the European part of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1331–1332.
CCDB · ipcn-api-dl — Sorokin, S. N. 1993. Karyosystematic study of some members of the tribe Aveneae (Poaceae). Bot. Žhurn. (Moscow & Leningrad) 78(4): 36–47.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn66 — Love & Love 1966b
CCDB · book-ipcn67-71 — FAVARGER, c. 1969. Notes de caryologie Alpine V. Bull. Soc. Neuchateloise Sci. Nat. 92: 13-30.
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · book-ipcn75-78 — Albers 1972
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1975
CCDB · book-ipcn75-78 — Probatova & Sokolovskaya 1978
CCDB · book-northern-plants — Stahlin 1929. L. & L. 1944 b.
CCDB · book-ipcn73-74 — ALBERS, F. 1972. Cytosystematische untersuchungen in der Subtribus Deschampsiineae Holub (Tribus Aveneae Nees). II. Die Gattungen Vahlodea Fr. und Avenella Koch. Ber. Deutsch. Bot. Ges. 85: 279-285.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol2 — Albers, F. 1972b
CCDB · eflora
CCDB · kew — Albers F. 1980. Comparative karyology of the grass subtribes Aristaveninae and Airinae (Poaceae - Aveneae). Plant Systematics and Evolution 136: 137-167.
CCDB · kew — Band SR. (pers. comm. 1984).
CCDB · Cave1956 — Love & Love b
CCDB · Cave1956supp — Stahlin 1929
CCDB · Cave1958 — Jorgensen et al. '58
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal (1997). Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365-368.
CCDB · CromoCat 2015 — Petrova, A. & K. Stoyanova. (1998). Mediterranean chromosome number reports-8. Fl. Medit. 8: 251-262.
CCDB · CromoCat 2015 — Stoeva, M. P. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 579-580.
+2 more references
2n 566×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +1
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 1-15. Queirs, M.Bol. Soc. Brot. ser. 252: 69-77(1978).
CCDB · fl-europaea — Albers, 1972
CCDB · ipcn-api-dl — García-Suárez, R., E. Alvarez, J. A. F. Prieto, M. C. Fernández-Carvajal & R. Giraldez. 1997. Diversity of Avenella Drejer (Gramineae) in the Iberian Peninsula inferred from micromorphology, cytogenetic analysis, isozyme assays and in situ hybridization. Bot. J. Linn. Soc. 124: 309–318.
CCDB · ipcn-api-dl — García-Suárez, R., C. Alonso-Blanco, M. C. Fernandez-Carvajal, J. A. Fernandez-Prieto, A. Roca & R. Giraldez. 1997. Diversity and systematics of Deschampsia sensu lato (Poaceae) inferred from karyotypes, protein electrophoresis, total genomic DNA hybridization and chloroplast DNA analysis. Pl. Syst. Evol. 205: 99–110.
CCDB · ipcn-api-dl — Albers, F. 1980. Comparative karyology of the grass subtribes Aristaveninae and Airinae (Poaceae-Avenae). Pl. Syst. Evol. 136: 137–167.
CCDB · book-ipcn73-74 — ALBERS, F. 1972. Cytosystematische untersuchungen in der Subtribus Deschampsiineae Holub (Tribus Aveneae Nees). II. Die Gattungen Vahlodea Fr. und Avenella Koch. Ber. Deutsch. Bot. Ges. 85: 279-285.
2n 144×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ipcn-api-dl — Duckert-Henriod, M. M. 1991. Mediterranean chromosome number reports 1 (7--25). Fl. Medit. 1: 229–236.
CCDB · CromoCat 2015 — Stoeva, M. P. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 579-580.
CCDB · CromoCat 2015 — Stoeva, M. P. (1983). Populacionna izmencivost v kadravata plastica (Deschampsia flexuosa (L.) Trin.). In: Treta nacionalna konferencija po botanika : 341-346.
2n 263×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · fl-europaea — Delay, 1970
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
2n 421×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hedberg, O. (1952). Cytological studies in East African mountain grasses. Hereditas 38: 256-266.
2n 701×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Albers 1978
n 72×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Duckert-Henriod, M. M. 1991. Mediterranean chromosome number reports 1 (7--25). Fl. Medit. 1: 229–236.
CCDB · CromoCat 2015 — Duckert-Henriod, M. M. (1991). In: G. Kamari, F. Felber & F. Garbari (Eds.), Mediterranean chromosome number reports, 7-25. Fl. Medit. 1: 229-236.
n 142×CCDB · Cave1963 · CCDB · CromoCat 2015
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Duckert-Henriod, M. M. (1991). In: G. Kamari, F. Felber & F. Garbari (Eds.), Mediterranean chromosome number reports, 7-25. Fl. Medit. 1: 229-236.
n 131×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — DELAY, J. 1970. Orophytes. Inf. Ann. Caryosyst. et Cytogenet. 4: 1-16.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.025 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type551 973 records
Wild obs. + sensor536 027
Museum / vouchered11 639
Cultivated / captive20
Other4 287
Origin
Native15 460
Range
Area of Occupancy AOO511 240 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 191 494≤1 km 131 779≤10 km 189 752>10 km 1 624
514 649 georeferenced · 21 378 without coordinates
Open the mapobservation + sensor536 027
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy29% within 1 km
≤100 m 670≤1 km 2 178≤10 km 6 249>10 km 743
9 840 georeferenced · 1 799 without coordinates
Open the institutions mapphysical evidence11 639
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤1 km 1>10 km 13
14 georeferenced · 6 without coordinates
Open the mapnot free-living20
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions68 of 144 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 6 940 |
| Helsinki, FI | 566 |
| LDlocation not on record | 408 |
| Moscow State Universitylocation not on record | 396 |
| Olocation not on record | 272 |
| MeiseBGlocation not on record | 220 |
| TROMlocation not on record | 189 |
| Bergen, NO | 171 |
| Trondheim, NO | 161 |
| Oulu, FI | 138 |
| Garðabær, IS | 118 |
| Oskarshamn, SE | 102 |
| Shinshu Universitylocation not on record | 95 |
| Turku, FI | 92 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 87 |
| University of Stellenboschlocation not on record | 86 |
| Ann Arbor, US | 84 |
| SLU Artdatabankenlocation not on record | 70 |
| KMNlocation not on record | 70 |
| Bronx, US | 59 |
| Toyama, JP | 59 |
| Bern, CH | 57 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 55 |
| Kuopio, FI | 48 |
| Provincia di Livornolocation not on record | 46 |
| Kandalaksha State Nature Reservelocation not on record | 42 |
| Québec, CA | 42 |
| DBF-NHMDlocation not on record | 41 |
| Nagano City, JP | 41 |
| Montréal, CA | 40 |
| JP | 39 |
| Madrid, ES | 37 |
| Wlocation not on record | 35 |
| Omachi Alpine Museumlocation not on record | 35 |
| 29 | |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 29 |
| San Isidro, AR | 26 |
| BRNUlocation not on record | 25 |
| GJOlocation not on record | 19 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 18 |
| SIHUlocation not on record | 11 |
| TUR-Alocation not on record | 11 |
| Glarus, CH | 10 |
| South Kensington, GB | 10 |
| Université Lavallocation not on record | 10 |
| Porvoo, FI | 10 |
| J.F.Oberlin Universitylocation not on record | 10 |
| Berlin, DE | 9 |
| BFLlocation not on record | 9 |
| Lord Fairfax Community Collegelocation not on record | 8 |
| Fukushima Universitylocation not on record | 8 |
| GZUlocation not on record | 8 |
| Saint Louis, US | 8 |
| Sendai, JP | 8 |
| Columbia, US | 8 |
| BSBIlocation not on record | 7 |
| Tromso University Museumlocation not on record | 7 |
| Madison, US | 6 |
| Dekalb, US | 5 |
| Iwate Prefectural Museumlocation not on record | 5 |
| Kew, GB | 5 |
| nbflocation not on record | 5 |
| Tomioka, JP | 4 |
| Ciudad Autónoma de Buenos Aires, AR | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| València, ES | 4 |
| Castelar, AR | 4 |
| Bourges, FR | 4 |
| SWlocation not on record | 4 |
| Pamplona, ES | 4 |
| Lausanne, CH | 4 |
| Frauenfeld, CH | 4 |
| Mlocation not on record | 4 |
| National Museum Waleslocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Córdoba, AR | 3 |
| Acadia Universitylocation not on record | 3 |
| CZE082location not on record | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| PRClocation not on record | 3 |
| Kochi, JP | 3 |
| Forssa, FI | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Oswego, US | 2 |
| Chapel Hill, US | 2 |
| MAlocation not on record | 2 |
| Tilburg, NL | 2 |
| Green Bay, US | 2 |
| Guasave, MX | 2 |
| Appalachian State Universitylocation not on record | 2 |
| BClocation not on record | 2 |
| Porrentruy, CH | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Otaru, JP | 2 |
| WINlocation not on record | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Brussel, BE | 2 |
| Alicante, ES | 2 |
| Sion, CH | 2 |
| McGill University, Herbariumlocation not on record | 2 |
| San Angelo, US | 2 |
| Rovaniemi, FI | 2 |
| Fairfax, US | 2 |
| WTUlocation not on record | 2 |
| Clemson, US | 2 |
| Toronto, CA | 1 |
| GAlocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Christchurch, NZ | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Williamsburg, US | 1 |
| UniKSlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Lubbock, US | 1 |
| BioFokuslocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Santiago, CL | 1 |
| Tempe, US | 1 |
| UChlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Dresden, DE | 1 |
| University of Hulllocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| LfUlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Zürich, CH | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Göteborg, SE | 1 |
| NMBU:MINAlocation not on record | 1 |
| Mexico City, MX | 1 |
| Honolulu, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Montréal, CA | 1 |
| Podgorica, ME | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
144 institutions · 11 425 of 11 639 vouchered records shown · 212 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA469 detections
Where the DNA of Avenella flexuosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found469
Studies independent surveys2
Countries14
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 469 detections have coordinates
Open the map14 countries0
Submesic Dwarf Shrub - Herb-Lichenin grassy habitat
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.1 °C 7.50–14.7
Seasonal swing summer↔winter21.6 °C
Max temp (day)13.5 °C 9.70–17.9
Min temp (night)7.00 °C 2.90–11.1
Precipitation116 mm/mo 65.6–196
Air humidity63.7 % 61.2–67.0
Moisture balance33.1 mm/mo -18.3–224
Vapour deficit465 Pa 342–630
Wind speed4.60 m/s 2.70–9.50
Cloud cover63.0 % 50.5–64.1
CHELSA 1981–2010, ~9 km grid, at location & month of 450 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.