Avena sterilis
speciesAt a glance
Occurrence records62 383
Data sources12
Biological traits56
DNA specimens29
eDNA detections25
Sources12 archives
Databases and archives Avena sterilis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility62 383 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics29 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources56 traits
Chemical compositionLOTUS4 compounds
Occurrence & distributionGBIF62 383 records
Environmental DNA1 datasets · 5 countries25 detections
DNA & barcodingBOLD · NCBI29 specimens
Genome at a glanceCCDB · GoaT · NCBI13.6 Gbp
01Narrative
Avena sterilis, l'Avoine à grosses graines, est une plante herbacée de la famille des Poacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology18
Fruit length8.3 mm
Inflorescence length max45 cm
Inflorescence length min20 cm
Leaf length450 mm
Leaf length max300 mm
Leaf length min200 mm
Leaf mass17.32 mg
Leaf size561 mm²
Leaf width14 mm
⚠ sources differ — AusTraits: 14 mm · GIFT: 9 mm
Leaf width max12 mm
Leaf width min4 mm
Plant height0.27 m
⚠ sources differ — GIFT: 0.27 m · AusTraits: 1.5 m · LEDA: 0.27 m · TRY: 0.685 m
Plant height generative0.483 m
Plant height max1.6 m
Plant height min0.2 m
Seed mass19.46 mg
⚠ sources differ — TRY: 19.46 mg · LEDA: 59.23 mg · GIFT: 37.99 mg
Seed mass max16.74 mg
Seed mass min16.74 mg
Life cycle & reproduction14
Deciduousnessdeciduous
Dispersal typeanimal
Flower length max40 mm
Flower length min25 mm
Flowering endAug
Flowering startApr
Flowering timennnnnnnnyyyn
Life formannual
Life spanannual
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number511
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 300 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: graminoid-annual
Habitat GIFT(?)
Leaf compoundnesssimple
Mycorrhiza type0.00000000142
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio17.61 g/g
Leaf c404 mg/g
Leaf dry-matter content (LDMC)206 mg/g
⚠ sources differ — TRY: 206 mg/g · LEDA: 193 mg/g
Leaf n22.17 mg/g
Leaf p2.73 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)18.92 mm²/mg
⚠ sources differ — TRY: 18.92 mm²/mg · LEDA: 33.18 mm²/mg · GIFT: 33.18 mm²/mg
Other traits2
Diaspore typepart of infructescence
Inflorescencepanicle
03Chemical composition4 compounds
Compounds documented for Avena sterilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Oleanane triterpenoids4
Documented compounds4 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Avenacin A 1 | present | LOTUS | |
| avenacin A-2 | present | LOTUS | |
| avenacin B-1 | present | LOTUS | |
| Avenacin B-2 | present | LOTUS |
05DNA & barcoding29 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Avena sterilis has left across the world's sequence archives.
At a glance
DNA specimens29
Marker genes6
GenBank sequences10
eDNA detections25
Countries7
The DNA barcodea real sequence read deposited for this species
GCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCTAAACACGCTCCCA …
Avena sterilis subsp. sterilis voucher PLT.0110 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★rbcLa★trnL-F★ITS7★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Avena sterilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size13 594 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Avena sterilis13.59 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidy6× hexaploid · measured
Chromosome records28–442n range42median42mode79records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4272×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +13
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CONTE L., CRISTOFOLINI G., BONOMO M.C. - 1995. Biosistematica del genere avena L. (Poaceae): Analisi della rubisco nelle specie poliploidi.. Giorn. Bot. Ital. , 129(2): 40.
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 2 Queirs, M.Bol. Soc. Brot. ser. 248: 81-98(1974).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 337-341. Romero Zarco, C.Lagascalia12(2): 292-294(1984).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4520
CCDB · fl-europaea — Dahlgren et al.,
CCDB · fl-europaea — Fernandes & Queiros
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Slavĭk, B., V. Jarolĭmovă & J. Chrtek. 1993. Chromosome counts of some plants from Cyprus. Candollea 48(1): 221–230.
CCDB · ipcn-api-dl — Bullen, M. R. & H. Rees. 1972. Nuclear variation within Aveneae. Chromosoma 39: 93– 100.
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Wu, S. h., X. x. Li, M. z. Li, X. l. Zhang & C. o. Liu. 1994. A study on the karyotypes of Avena sterilis and A. nuaidrevis. J. Inner Mongol. Inst. Agric. Anim. Husb. 15(2): 56–59.
CCDB · ipcn-api-dl — Wu, S. h., X. x. Li, X. y. Zhao, L. z. Mao & L. Zhang. 1997. A comparison of karyotypes between naked oat (Avena nuda L.) and common oat (A. sterilis L.). J. Inner Mongol. Inst. Agric. Anim. Husb. 18(4): 12–15.
CCDB · ipcn-api-dl — Yu, Y., P. d. Chen & D. j. Liu. 1998. Cytogenetic study on cross between Avena nuda and A. sterilis. J. Nanjing Agric. Univ. 21(4): 1–6.
CCDB · ipcn-api-dl — LABADIE, J. 1979. Etude caryosystematique de quelques especes de la flore d'Algerie. Nat. Monspel., Sér. Bot. 32: 1–11.
CCDB · ipcn-api-dl — LABADIE, J. 1979a. In IOPB chromosome number reports LXV. Taxon 28: 628–629.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn75-78 — Magulaev 1976
CCDB · book-ipcn75-78 — Queiros 1974
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dj spermatophyta de Portugal. I. Gramineae, Supl. I. Bol. Soc. Brot. I 4 7 ( Ser . 2 ) : 7 7- 1 0 3 .
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-indian_vol2 — Huskins, C.L. 1926, 1927 ; Emme, H.K. (Fedorov); Hubbard, C.E. 1954 ; Fernandes, A. & Queiros, M. 1969; Mehra, P.N. & Sharma, M.L. 1975c
CCDB · book-indian_vol2 — Kihara, H. 1919b, 1924 ; Huskins, C.L. 1926, 1927 ; Nishiyama, I. 1929; Emme, H.K. (Fedorov) ; Spier, J.D. 1934 ; Delay, C. 1947 ; Ngkao, S. & Mori, S. 1956 ; Rajhathy, T. & , Morrison, J.W. 1959 ; Thomas, P.T. 1962 ; Holden, J.H.W. 1969; Dahlgren, R. et al. 1971 ; Faruqi, S.A. & Quraish, H.B. 1979
CCDB · book-indian_vol2 — Labadie, J.P. 1979
CCDB · eflora
CCDB · book-atlas-flowering-plants — Huskins 1927
CCDB · book-atlas-flowering-plants — Spier 1934
CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.
CCDB · Cave1959 — Rajh. & Morris. 1959a
CCDB · Cave1963 — Thomas 1962
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Kliphuis, E. & Barkoudah, Y. I. (1977). Chromosome numbers in some Syrian Angiosperms. Acta Bot. Neerl. 26: 239-249.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
CCDB · CromoCat 2015 — Queirós, M. (1974a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. I. Gramineae, supl. 2. Bol. Soc. Brot. 48: 81-98.
CCDB · CromoCat 2015 — Wu, S.-h., X.-x. Li, M.-z. Li, X.-l. Zhang & C.-o. Liu (1994). A study on the karyotypes of Avena sterilis and A. nuaidrevis J. Inner Mongol. Inst. Agric. Anim. Husb. 15(2): 56-59
CCDB · CromoCat 2015 — Wu, S.-h., X.-x. Li, X.-y. Zhao, L.-z. Mao & L. Zhang (1997). A comparison of karyotypes between naked oat (Avena nuda L.) and common oat (A. sterilis L.) J. Inner Mongol. Inst. Agric. Anim. Husb. 18(4): 12-15
CCDB · CromoCat 2015 — Yu, Y., P.-d. Chen & D.-j. Liu (1998). Cytogenetic study on cross between Avena nuda and A. sterilis Journal of Nanjing Agricultural University 21(4): 1-6
CCDB · CromoCat 2015 — Emme, H. (1930a). Uber chromosomen von hafer und haferbastarden. Züchter 2: 65-68.
+20 more references
2n 285×CCDB · ita-fl · CCDB · book-indian_vol2 · CCDB · Cave1956supp
CCDB · ita-fl — MARTINOLI G. - 1955. Citotassonomia di alcune specie del genere Avena della Sardegna.. Caryologia , 7(1): 191-204.
CCDB · book-indian_vol2 — Martinoli, G. 1955b
CCDB · Cave1956supp — Martinoli 1955b
2n 442×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Nikolaeva, A.G. (Fedorov)
2n 431×CCDB · Cave1959
CCDB · Cave1959 — Rajh. & Morris. 1959a.
n 215×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 206-209. Araujo, E. & S. Talavera.Lagascalia10(2): 233-235(1981).
CCDB · ipcn-api-dl — Bullen, M. R. & H. Rees. 1972. Nuclear variation within Aveneae. Chromosoma 39: 93– 100.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn75-78 — Mehra & Sharma 1975b
CCDB · CromoCat 2015 — Araujo, E. & Talavera, S. (1981). Números cromosómicos para la flora española. 206-209. Lagascalia 10(2): 233-235.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type62 383 records
Wild obs. + sensor14 343
Museum / vouchered1 948
Cultivated / captive142
Other45 950
Origin
Native38 904
Introduced787
Range
Area of Occupancy AOO40 244 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 1 724≤1 km 2 209≤10 km 3 719>10 km 182
7 834 georeferenced · 6 509 without coordinates
Open the mapobservation + sensor14 343
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 21≤1 km 104≤10 km 120>10 km 7
252 georeferenced · 1 696 without coordinates
Open the institutions mapphysical evidence1 948
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 14>10 km 3
17 georeferenced · 125 without coordinates
Open the mapnot free-living142
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions53 of 96 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 221 |
| LDlocation not on record | 61 |
| Berlin, DE | 53 |
| Rishon Le Zion, IL | 51 |
| València, ES | 39 |
| Barcelona, ES | 28 |
| MAlocation not on record | 21 |
| Wlocation not on record | 21 |
| Museo Entomologico de Leonlocation not on record | 17 |
| BDBClocation not on record | 16 |
| CICYTEXlocation not on record | 15 |
| GJOlocation not on record | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| BRNUlocation not on record | 12 |
| Dresden, DE | 11 |
| Saint Louis, US | 10 |
| UIBlocation not on record | 10 |
| Uppsala, SE | 10 |
| BClocation not on record | 9 |
| San Diego, US | 9 |
| Cape Town, ZA | 8 |
| Phyletisches Museum Jenalocation not on record | 8 |
| Badajoz, ES | 8 |
| Kew, GB | 8 |
| Mount Annan, AU | 8 |
| College of the Atlantic, Museumlocation not on record | 7 |
| Moscow State Universitylocation not on record | 7 |
| Bronx, US | 6 |
| Salamanca, ES | 6 |
| Olocation not on record | 6 |
| Sevilla, ES | 6 |
| Sanda, JP | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Coimbra, PT | 5 |
| Parkville, AU | 5 |
| PRClocation not on record | 5 |
| Bern, CH | 5 |
| Davis, US | 5 |
| Paris, FR | 5 |
| Philadelphia, US | 4 |
| Pamplona, ES | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Canberra, AU | 4 |
| UGentlocation not on record | 3 |
| Wellington, NZ | 3 |
| Henry Brockhouse Collectionlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Xiamen, CN | 3 |
| South Kensington, GB | 3 |
| Pretoria, ZA | 2 |
| Edinburgh, GB | 2 |
| H-Merxmlocation not on record | 2 |
| Brussel, BE | 2 |
| Auckland, NZ | 2 |
| WTUlocation not on record | 2 |
| MeiseBGlocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| Alicante, ES | 2 |
| Karlsruhe, DE | 2 |
| Córdoba, ES | 2 |
| Christchurch, NZ | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Loja, EC | 1 |
| JBSlocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Claremont, US | 1 |
| Göteborg, SE | 1 |
| Madrid, ES | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Riverside, US | 1 |
| Cape Town, ZA | 1 |
| Mlocation not on record | 1 |
| Bloomington, US | 1 |
| Santa Barbara, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Stockholm, SE | 1 |
| Córdoba, AR | 1 |
| ESP003location not on record | 1 |
| POL003location not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Tampa, US | 1 |
| Görlitz, DE | 1 |
| Banyoles, ES | 1 |
| Chicago, US | 1 |
| Irvine, US | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Aarhus, DK | 1 |
| BFLlocation not on record | 1 |
| Salzburg, AT | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Oskarshamn, SE | 1 |
96 institutions · 858 of 1 948 vouchered records shown · 1 087 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA25 detections
Where the DNA of Avena sterilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found25
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 25 detections have coordinates
Open the map5 countries0
Chaparral, keep including grasses, hervs, vi…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.3 °C 14.0–18.3
Seasonal swing summer↔winter14.6 °C
Max temp (day)19.6 °C 18.4–23.6
Min temp (night)9.20 °C 8.40–13.8
Precipitation69.5 mm/mo 26.8–84.3
Air humidity57.1 % 53.2–60.6
Moisture balance-42.1 mm/mo
Vapour deficit778 Pa 648–1,061
Wind speed2.80 m/s
Cloud cover35.4 % 22.2–39.6
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.