Avena sativa
speciesAt a glance
Occurrence records73 786
Data sources18
Biological traits142
DNA specimens45
eDNA detections27
Sources18 archives
Databases and archives Avena sativa's data was compiled from.
WikipediaWikimedia Foundation22 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility73 785 records↗
OBISOcean Biodiversity Information System1 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics45 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources142 traits
Chemical compositionDukesPhytochem · FooDB · LOTUS · NPASS6 224 compounds
Occurrence & distributionGBIF · OBIS73 786 records
Environmental DNA1 datasets · 7 countries27 detections
DNA & barcodingBOLD · NCBI45 specimens
Genome at a glanceCCDB · GoaT · NCBI12.9 Gbp
01Narrative
The oat (Avena sativa), sometimes called the common oat, is a species of cereal grain grown for its seed, which is known by the same name (usually in the plural, unlike other cereals and pseudocereals). While oats are suitable for human consumption as oatmeal and rolled oats, one of the most common uses is as livestock feed.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology28
Fruit length10.7 mm
Inflorescence length max30 cm
Inflorescence length min15 cm
Leaf length325 mm
Leaf length max450 mm
Leaf length min200 mm
Leaf mass169 mg
Leaf mass per area54.03 g/m2
Leaf size4 611 mm²
⚠ sources differ — TRY: 4 611 mm² · LEDA: 4 344 mm² · GIFT: 4 344 mm²
Leaf width14 mm
⚠ sources differ — AusTraits: 14 mm · GIFT: 11 mm
Leaf width max20 mm
Leaf width min5 mm
Plant height0.847 m
⚠ sources differ — GIFT: 0.847 m · AusTraits: 1.5 m · LEDA: 0.93 m · USDA: 0.61 m · TRY: 1.13 m
Plant height generative1.12 m
Plant height max1.6 m
Plant height min0.6 m
Seed length6 mm
Seed length max6 mm
Seed length min6 mm
Seed mass33.38 mg
⚠ sources differ — TRY: 33.38 mg · AusTraits: 31.5 mg · LEDA: 30.71 mg · GIFT: 28.53 mg
Seed mass max39.2 mg
Seed mass min5.65 mg
Seed volume32 mm³
Seed volume max32 mm³
Seed volume min32 mm³
Seed width2.2 mm
Seed width max2.2 mm
Seed width min2.2 mm
Life cycle & reproduction34
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typeanimal
Flower colouryellow
Flower conspicuousNo
Flowering endAug
Flowering startJun
Flowering timennnnnnnnyyyn
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number340
Seed spread rateNone
Seedling vigorHigh
Self fertilizationpresent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: herbaceous
Growth form USDABunch
Habitat GIFTÁrea Antrópica, Campo Limpo
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainYes
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceLow
C:N ratioLow
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min90 days
Leaf dry-matter content (LDMC)174 mg/g
⚠ sources differ — TRY: 174 mg/g · LEDA: 193 mg/g
Leaf n9.91 mg/g
Leaf p1.27 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max100 in
Precipitation min25 in
Protein potentialMedium
Salinity toleranceMedium
Seed longevity index0
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min5.3 pH
Specific leaf area (SLA)15.73 mm²/mg
⚠ sources differ — TRY: 15.73 mm²/mg · LEDA: 20.68 mm²/mg · GIFT: 20.68 mm²/mg
Temperature min-23 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalHigh
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound19 400 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typefruit with appendage
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Shoot orientationascending
03Chemical composition6 224 compounds
Compounds documented for Avena sativa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingCereals and cereal products
Compound class profile5 classes
Aminoacids237
Cinnamic acids and derivatives61
Glycerophospholipids57
Pyridine alkaloids52
pteridine alkaloids40
Documented compounds6 224 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| CARBOHYDRATES | 861,000 ppm | DukesPhytochem | |
| WATER | 792,000 ppm | DukesPhytochem | |
| FIBER(DIETARY) | 620,000 ppm | DukesPhytochem | |
| STARCH | 600,000 ppm | DukesPhytochem | |
| PROTEIN | 424,000 ppm | DukesPhytochem | |
| FIBER | 417,000 ppm | DukesPhytochem | |
| PENTOSANS | 360,000 ppm | DukesPhytochem | |
| CELLULOSE | 350,000 ppm | DukesPhytochem |
05DNA & barcoding45 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Avena sativa has left across the world's sequence archives.
At a glance
DNA specimens45
Marker genes11
GenBank sequences10
eDNA detections27
Countries7
The DNA barcodea real sequence read deposited for this species
CGCTAAACACGCTCCCAACCCCTTACGGGGGAACAGGATGCGGCATTTGGCTCCCCGTCACCCAAGGGCGGTGGGCCGAAGATATGGCTG …
Avena sativa internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★trnL-F★ITS10★ITS1★ITS2psbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Avena sativa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size12 909 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Avena sativa12.91 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidy6× hexaploid · measured
Chromosome records42–482n range42median42mode32records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4230×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CONTE L., CRISTOFOLINI G., BONOMO M.C. - 1995. Biosistematica del genere avena L. (Poaceae): Analisi della rubisco nelle specie poliploidi.. Giorn. Bot. Ital. , 129(2): 40.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4521
CCDB · poland — Mizianty M., Mirek Z. and Frey L. 1983. Chromosome numbers of Polish vascular plants (Part 4). Acta Soc. Bot. Pol. 52, 205-214.
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 161–162.
CCDB · ipcn-api-dl — Mizianty, M., Z. Mirek & L. Frey. 1983. Chromosome numbers of Polish vascular plants (Part 4). Acta Soc. Bot. Poloniae 52: 205–214.
CCDB · ipcn-api-dl — Jones, M., H. Rees & G. Jenkins. 1989. Synaptonemal complex formation in Avena polyploids. Heredity 63: 209–219.
CCDB · ipcn-api-dl — Guillin, E., L. Poggio & C. A. Naranjo. 1995. Meiotic irregularities in Argentinian hexaploid oats. Cytologia 60: 211–215.
CCDB · ipcn-api-dl — Thomas, H. & N. Al-ansari. 1980. Genotypic control of chromosome pairing in Avena -longiglumis X A. sativa hybrids. Chromosoma 79: 115–124.
CCDB · ipcn-api-dl — Bullen, M. R. & H. Rees. 1972. Nuclear variation within Aveneae. Chromosoma 39: 93– 100.
CCDB · ipcn-api-dl — Hafiz, H. M. I. 1980. Transmission of deficient gametes by monosomics of Avena sativa L. Pakistan J. Bot. 12: 1–12.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang, Z. p. An, C. b. Chen, Z. x. Qi & Y. z. Sun. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 2, Chromosome Atlas of Crops and their Wild Kindred Plants in China Relatives. Science Press, Beijing.
CCDB · book-ipcn66 — Hacker 1966b; McGinnis & Lin 1966; Swami & Thomas 1966
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-ipcn67-71 — THOMAS, H. 1968. The addition of single chromosomes of Avena hirtula to the cultivated hexaploid oat A. sativa. Canad. J. Genet. Cytol. 10: 551-563. - ~~~
CCDB · book-ipcn67-71 — SADASIVAIAH, R.S., R. WATKINS, & T. RAJHATHY. 1969. Somatic associations of chromosomes in diploid and hexaploid Avena. Chromosoma 28: 468-481.
CCDB · book-ipcn67-71 — Q9 LADIZINSKY, G., & D. ZOHARY. 1971. Notes on species delimitation, species relationships and polyploidy in Avena. Euphytica 20: 380-395.
CCDB · book-indian_vol2 — Kihara, H. 1919b, 1924; Winge, 0. 1925 ; Aase, H.C. & Powers, L.R. 1926; Huskins, C.L. 1926 ; Church, G.L. 1929a ; Emme, H.K. (Fedorov); Shepeleva, Y.M. (Fedorov) ; Rajhathy, T. & Morrison, J.W. 1959; Rajhathy, ~ 1963 ; Marenah, L.J. & Holden, J.H.W. 1967; Mehra, P.N. et al. 1968 ; Thomas, H. 1968 ; Sadasivaiah, R.S. et at. 1969 ; Forsberg, R.A. & Wang, S. 1971 ; Ladizinsky, G. & Zohary, D. 1971 ; Aung, T. & Thomas, H. 1978 ; Sharma, D.C. 1978 ; Faruqi, S.A. & Quraish, H.B. 1979 ; Kliphuis, E. & Wieffering, J.H. 1979
CCDB · eflora
CCDB · book-atlas-flowering-plants — Emme 1930
CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.
CCDB · Cave1959 — Rajh. & Morris. 1959&
CCDB · Cave1963 — Thomas 1962
CCDB · Original-count — Röser, M., Winterfeld, G., Grebenstein, B., Hemleben, V. (2001). Molecular diversity and physical mapping of 5S rDNA in wild and cultivated oat grasses (Poaceae: Aveneae). Molec. Phylogen. Evol. 21: 198–217. doi: 10.1006/mpev.2001.1016
CCDB · Original-count — Winterfeld, G., Döring, E., Röser, M. (2009). Chromosome evolution in wild oat grasses (Aveneae) revealed by molecular phylogeny. Genome 52: 361–380. doi:10.1139/G09-014
2n 412×CCDB · ipcn-api-dl · CCDB · book-indian_vol2
CCDB · ipcn-api-dl — Parkash, O. 1979. Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
CCDB · book-indian_vol2 — Ilyas, H. & Muhammad, H. 1977
2n 482×CCDB · iapt · CCDB · book-indian_vol2
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · book-indian_vol2 — Nikolaeva, A.G. (Fedorov)
n 216×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
CCDB · ipcn-api-dl — Bullen, M. R. & H. Rees. 1972. Nuclear variation within Aveneae. Chromosoma 39: 93– 100.
CCDB · ipcn-api-dl — Parkash, O. 1979. Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
CCDB · ipcn-api-dl — Koul, K. K., R. Nagpal & A. Sharma. 2000. Chromosome behaviour in the male and female sex mother cells of wheat (Triticum aestivum L.), oat (Avena sativa L.) and pearl millet (Pennisetum americanum (L.) Leeke). Caryologia 53: 175–183.
CCDB · book-ipcn67-71 — MARENAH, L.J., & J. H. w. HOLDEN. 1967. Karyotype studies in Avena I. The karyotype of Avena sativa cultivar Condor. Chromosoma 22: 456-464.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
07Deep time~0.78 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.78 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type73 786 records
Wild obs. + sensor50 898
Museum / vouchered6 781
Cultivated / captive2 912
Other13 195
Origin
Native153
Introduced3 705
Range
Area of Occupancy AOO148 980 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy44% within 1 km
≤100 m 14 931≤1 km 5 723≤10 km 25 722>10 km 220
46 596 georeferenced · 4 302 without coordinates
Open the mapobservation + sensor50 898
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 444≤1 km 987≤10 km 1 696>10 km 258
3 385 georeferenced · 3 396 without coordinates
Open the institutions mapphysical evidence6 781
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy16% within 1 km
≤1 km 17≤10 km 68>10 km 22
107 georeferenced · 2 805 without coordinates
Open the mapnot free-living2 912
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions242 of 421 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| ESP004location not on record | 1 152 |
| Uniwersytet Wrocławskilocation not on record | 1 041 |
| ROM007location not on record | 190 |
| Kuopio, FI | 146 |
| LDlocation not on record | 145 |
| Olocation not on record | 119 |
| Helsinki, FI | 113 |
| BIO-UNIPIlocation not on record | 91 |
| Oskarshamn, SE | 85 |
| Moscow State Universitylocation not on record | 84 |
| Museo Entomologico de Leonlocation not on record | 57 |
| Uniwersytet Warszawskilocation not on record | 54 |
| Philadelphia, US | 53 |
| Adelaide, AU | 52 |
| Trondheim, NO | 51 |
| Durango, MX | 50 |
| Uppsala, SE | 46 |
| Jyväskylä, FI | 44 |
| Provincia di Livornolocation not on record | 44 |
| Chongqing Museumlocation not on record | 44 |
| Québec, CA | 43 |
| Karlsruhe, DE | 43 |
| Mount Annan, AU | 42 |
| TROMlocation not on record | 41 |
| Tartu, EE | 40 |
| Madison, US | 40 |
| Bern, CH | 39 |
| International Salmonella Centre (W.H.O.)location not on record | 39 |
| Bergen, NO | 39 |
| Bronx, US | 38 |
| Canberra, AU | 38 |
| Brisbane, AU | 38 |
| Mexico City, MX | 37 |
| Saint Louis, US | 35 |
| Austin, US | 33 |
| Beijing, CN | 33 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 32 |
| POL003location not on record | 32 |
| Görlitz, DE | 30 |
| Claremont, US | 28 |
| University of Stellenboschlocation not on record | 27 |
| SLU Artdatabankenlocation not on record | 27 |
| Wuzhou, CN | 27 |
| KMNlocation not on record | 26 |
| GJOlocation not on record | 26 |
| Odawara, JP | 26 |
| Hobart, AU | 25 |
| Allentown, US | 25 |
| Pretoria, ZA | 25 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 25 |
| Ann Arbor, US | 24 |
| St. Paul, US | 24 |
| San Diego, US | 24 |
| Sanda, JP | 24 |
| Spearfish, US | 23 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 22 |
| Oulu, FI | 22 |
| ROM023location not on record | 21 |
| Fort Worth, US | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| Auckland, NZ | 21 |
| Istituto Agrario Castelnuovolocation not on record | 20 |
| Kensington, AU | 20 |
| WTUlocation not on record | 19 |
| Philadelphia, US | 18 |
| MAlocation not on record | 17 |
| Riverside, US | 17 |
| Davis, US | 17 |
| US | 17 |
| Tuscaloosa, US | 17 |
| Porvoo, FI | 16 |
| Logan, US | 16 |
| Kochi, JP | 16 |
| ESP010location not on record | 16 |
| Santa Barbara, US | 15 |
| Zapopan, MX | 15 |
| Pullman, US | 15 |
| València, ES | 14 |
| College Park, US | 14 |
| QAUlocation not on record | 14 |
| Columbia, US | 13 |
| Irkutsk State Universitylocation not on record | 13 |
| Garðabær, IS | 13 |
| Chadron, US | 13 |
| Bangkok, TH | 13 |
| Yangling, CN | 13 |
| Christchurch, NZ | 13 |
| Williamsburg, US | 12 |
| Mexico City, MX | 12 |
| BDBClocation not on record | 12 |
| Kew, GB | 12 |
| Nagano City, JP | 11 |
| BClocation not on record | 11 |
| Acadia Universitylocation not on record | 11 |
| Zacatecas, MX | 11 |
| Barcelona, ES | 11 |
| Dresden, DE | 11 |
| Université Lavallocation not on record | 11 |
| Berlin, DE | 11 |
| Victoria, CA | 11 |
| San Luis Obispo, US | 11 |
| Universidad de Caldas (UCaldas)location not on record | 11 |
| South Kensington, GB | 11 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| Tallinn, EE | 10 |
| New Haven, US | 10 |
| Albuquerque, US | 10 |
| Hazara Universitylocation not on record | 9 |
| University of Alberta Museumslocation not on record | 9 |
| Corvallis, US | 9 |
| Emporia, US | 9 |
| University of New Hampshirelocation not on record | 9 |
| Brussel, BE | 9 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 9 |
| Paris, FR | 9 |
| Montecillo, Texcoco, MX | 9 |
| Guangzhou, CN | 9 |
| Xining, CN | 9 |
| ASUlocation not on record | 8 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 8 |
| Palmerston, AU | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| 8 | |
| Tomioka, JP | 8 |
| Wellington, NZ | 8 |
| CASlocation not on record | 8 |
| Turku, FI | 8 |
| MeiseBGlocation not on record | 8 |
| BFLlocation not on record | 8 |
| Porrentruy, CH | 8 |
| Chapingo, MX | 8 |
| Bloomington, US | 8 |
| Denver, US | 8 |
| PUC-RSlocation not on record | 8 |
| Coimbra, PT | 7 |
| Armidale, AU | 7 |
| Bando, JP | 7 |
| Mlocation not on record | 7 |
| DBF-NHMDlocation not on record | 7 |
| UIBlocation not on record | 7 |
| Flagstaff, US | 7 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 7 |
| ENTClocation not on record | 7 |
| Phoenix, US | 7 |
| Wuhan, CN | 7 |
| Montréal, CA | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Ciudad de México, MX | 6 |
| Universidad de La Salle (La Salle)location not on record | 6 |
| TUR-Alocation not on record | 6 |
| Parkville, AU | 6 |
| Cape Town, ZA | 6 |
| Vancouver, CA | 6 |
| Jackson, US | 6 |
| Arcata, US | 6 |
| CICYTEXlocation not on record | 6 |
| Ciudad de México, MX | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| San Angelo, US | 6 |
| Mexico City, MX | 6 |
| Boise, US | 6 |
| Chapel Hill, US | 6 |
| SIHUlocation not on record | 6 |
| Salvador, BR | 5 |
| Rotorua, NZ | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| Guasave, MX | 5 |
| Dekalb, US | 5 |
| Zürich, CH | 5 |
| EL PASO, US | 5 |
| Wlocation not on record | 5 |
| Tilburg, NL | 5 |
| Salzburg, AT | 5 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 5 |
| Chiba, JP | 5 |
| Frauenfeld, CH | 5 |
| AUAlocation not on record | 4 |
| Angwin, US | 4 |
| Davenport, US | 4 |
| Bourges, FR | 4 |
| Green Bay, US | 4 |
| BAYLUlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Missoula, US | 4 |
| GB | 4 |
| Grand Junction, US | 4 |
| NSW Office of Environment and Heritagelocation not on record | 4 |
| Taipei, TW | 4 |
| Keene State Universitylocation not on record | 4 |
| Rovaniemi, FI | 4 |
| Guilin, CN | 4 |
| Clemson, US | 4 |
| Kawasaki Shi Tama Ku, JP | 4 |
| NLD037location not on record | 4 |
| KR | 4 |
| Knoxville, US | 4 |
| BRNUlocation not on record | 4 |
| Honolulu, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| Zürich, CH | 4 |
| Tokushima, JP | 4 |
| Cenargenlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Smithfield, AU | 3 |
| Toronto, CA | 3 |
| California Academy of Scienceslocation not on record | 3 |
| Moscow, US | 3 |
| Loja, EC | 3 |
| Chengdu, CN | 3 |
| CJBGlocation not on record | 3 |
| Chicago, US | 3 |
| Ciudad Juárez, MX | 3 |
| Stephenville, US | 3 |
| Xiamen, CN | 3 |
| Fayetteville, US | 3 |
| Sagamihara, JP | 3 |
| Fredericton Stock Culture Collectionlocation not on record | 3 |
| Nishihara, JP | 3 |
| Brasília, BR | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Whitehorse, CA | 3 |
| UNESClocation not on record | 3 |
| Northridge, US | 3 |
| Cascavel, BR | 3 |
| Torreón, MX | 3 |
| GAlocation not on record | 3 |
| Pamplona, ES | 3 |
| Glarus, CH | 3 |
| Russellville, US | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| QCNElocation not on record | 2 |
| University of Wisconsinlocation not on record | 2 |
| KNFHClocation not on record | 2 |
| Los Angeles, US | 2 |
| Juriquilla, MX | 2 |
| nlocation not on record | 2 |
| South African National Biodiversity Institutelocation not on record | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Sevilla, ES | 2 |
| Nanjing, CN | 2 |
| Dhaka, BD | 2 |
| US | 2 |
| Criciúma, BR | 2 |
| Zhengzhou, CN | 2 |
| Valdosta State Universitylocation not on record | 2 |
| National Biodiversity Institute, Costa Ricalocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| MCNAMlocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Santa Cruz, US | 2 |
| Kunming, CN | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Lubbock, US | 2 |
| GBR165location not on record | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Waverly, US | 2 |
| Alicante, ES | 2 |
| KMCClocation not on record | 2 |
| Nijmegen, NL | 2 |
| Salamanca, ES | 2 |
| Millersville, US | 2 |
| Université de Bordeauxlocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Catalina Island Conservancylocation not on record | 2 |
| Winterthur, CH | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Stockholm, SE | 2 |
| Blumenau, BR | 2 |
| La Paz, MX | 2 |
| Brasília, BR | 2 |
| Irvine, US | 2 |
| Xian, CN | 2 |
| Sion, CH | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Denton, US | 2 |
| Osaka, JP | 2 |
| Frankfurt am Main | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Lincoln, US | 2 |
| Foz do Iguaçu, BR | 2 |
| Edmonton, CA | 2 |
| PRClocation not on record | 2 |
| Awka, NG | 2 |
| UTFPR-DVlocation not on record | 2 |
| USFSlocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Riobamba, EC | 2 |
| TAIElocation not on record | 2 |
| GZUlocation not on record | 2 |
| Tsukuba, JP | 2 |
| Cape Town, ZA | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 2 |
| Chengdu, CN | 2 |
| Badajoz, ES | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 1 |
| Puerto Ayora, EC | 1 |
| Córdoba, AR | 1 |
| Orem, US | 1 |
| Staten Island, US | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Burlington, US | 1 |
| Pittsburg, US | 1 |
| BISHlocation not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| Portland, US | 1 |
| Bozeman, US | 1 |
| Pamplona, ES | 1 |
| Fulda, DE | 1 |
| Vitoria, ES | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Miami, US | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| San José, CR | 1 |
| Richmond, US | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Walla Walla, US | 1 |
| WNNUlocation not on record | 1 |
| Truckee, US | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Beijing, CN | 1 |
| The University of Arizonalocation not on record | 1 |
| BGPAlocation not on record | 1 |
| GMBAlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| MKD001location not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Morelia, MX | 1 |
| Zhejiang Universitylocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Ixtacuixtla de Mariano Matamoros, MX | 1 |
| UTPLlocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| KIRMlocation not on record | 1 |
| Firenze, IT | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Toyama, JP | 1 |
| Austin, US | 1 |
| Lanzhou, CN | 1 |
| Toluca, MX | 1 |
| Tampa, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 1 |
| Pocatello, US | 1 |
| SWE054location not on record | 1 |
| San Jose, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| UDESC-CAVlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Ensenada, MX | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Fairfax, US | 1 |
| UFMSlocation not on record | 1 |
| Ypsilanti, US | 1 |
| Corrientes, AR | 1 |
| nbflocation not on record | 1 |
| Turlock, US | 1 |
| UEMlocation not on record | 1 |
| Kagoshima, JP | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| La Paz, BO | 1 |
| Philadelphia, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Edinburgh, GB | 1 |
| IDElocation not on record | 1 |
| KURAlocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| UChlocation not on record | 1 |
| Kyoto Universitylocation not on record | 1 |
| University of Winnipeglocation not on record | 1 |
| Kingston, US | 1 |
| JBSlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Norfolk, US | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| KOMlocation not on record | 1 |
| Little Rock, US | 1 |
| Nishihara, JP | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| Chicago, US | 1 |
| Córdoba, ES | 1 |
| Henderson, US | 1 |
| UFBAlocation not on record | 1 |
| Bend, US | 1 |
| Durango, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| YUG027location not on record | 1 |
| Tacoma, US | 1 |
| Namur, BE | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Palmerston North, NZ | 1 |
| AUT001location not on record | 1 |
| UFSClocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| ESP003location not on record | 1 |
| Ivano-Frankove, UA | 1 |
| GBR016location not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Saint John, CA | 1 |
421 institutions · 6 466 of 6 781 vouchered records shown · 238 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA27 detections
Where the DNA of Avena sativa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found27
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 27 detections have coordinates
Open the map7 countries0
Coastal Sage Scrub/Canyon vegetation|metavol…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 5.50–20.7
Seasonal swing summer↔winter15.7 °C
Max temp (day)19.0 °C 7.00–26.7
Min temp (night)11.0 °C 1.90–15.4
Precipitation65.1 mm/mo 17.0–111
Air humidity61.9 % 54.3–65.7
Moisture balance-10.1 mm/mo
Vapour deficit666 Pa 325–1,104
Wind speed3.00 m/s
Cloud cover37.8 % 16.3–65.6
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.