Avena fatua
speciesAt a glance
Occurrence records126 228
Data sources15
Biological traits154
DNA specimens87
eDNA detections63
Sources15 archives
Databases and archives Avena fatua's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility126 228 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics87 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources154 traits
Chemical compositionLOTUS · NPASS39 compounds
Occurrence & distributionGBIF126 228 records
Environmental DNA2 datasets · 11 countries63 detections
DNA & barcodingBOLD · NCBI87 specimens
Genome at a glanceCCDB · GoaT · NCBI13.3 Gbp
01Narrative
La folle-avoine est une espèce de plantes monocotylédones de la famille des Poaceae (Gramineae), originaire d'Eurasie. Avena fatua est une plante herbacée annuelle qui s'est répandue et naturalisée dans toutes les régions de cultures de céréales du monde. C'est une des principales adventices des grandes cultures. Des populations de folle avoine ont été signalées depuis 1985 comme résistantes à diverses classes d'herbicides dans de nombreux pays.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology27
Inflorescence length max40 cm
Inflorescence length min10 cm
Leaf length300 mm
Leaf length max500 mm
Leaf length min100 mm
Leaf mass25.2 mg
⚠ sources differ — AusTraits: 25.2 mg · LEDA: 320 mg
Leaf mass per area54.03 g/m2
Leaf size1 650 mm²
⚠ sources differ — TRY: 1 650 mm² · AusTraits: 466 mm² · LEDA: 5 228 mm² · GIFT: 5 228 mm²
Leaf width11 mm
⚠ sources differ — AusTraits: 11 mm · GIFT: 10 mm
Leaf width max10 mm
Leaf width min4 mm
Plant height0.983 m
⚠ sources differ — GIFT: 0.983 m · AusTraits: 1.25 m · LEDA: 0.75 m · USDA: 1.22 m · TRY: 1.11 m
Plant height generative0.6 m
Plant height max1.6 m
Plant height min0.25 m
Seed length15.55 mm
⚠ sources differ — TRY: 15.55 mm · GIFT: 7 mm
Seed length max7 mm
Seed length min7 mm
Seed mass15.22 mg
⚠ sources differ — TRY: 15.22 mg · AusTraits: 12 mg · LEDA: 23.29 mg · GIFT: 20.99 mg
Seed mass max22.2 mg
Seed mass min4.15 mg
Seed volume12 mm³
Seed volume max12 mm³
Seed volume min12 mm³
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction39
After harvest regrowth rateSlow
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessvernal
⚠ sources differ — TRY: vernal · GIFT: deciduous
Dispersal typeanimal
Flower colouryellow
Flower conspicuousNo
Flower length max20 mm
Flower length min15 mm
Flowering endAug
Flowering startJun
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSpring
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityfire_killed
Seed number325
Seed spread rateRapid
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodFall, Winter and Spring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 900 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: graminoid-annual
Growth form USDABunch
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf formlinear-lanceolate
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceLow
Frost free days min100 days
Leaf C:N ratio35.59 g/g
Leaf c431 mg/g
Leaf dry-matter content (LDMC)238 mg/g
Leaf n21.2 mg/g
Leaf p1.75 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max24 in
Precipitation min6 in
Protein potentialHigh
Salinity toleranceLow
Seed longevity index0.5
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min6 pH
Specific leaf area (SLA)27.21 mm²/mg
⚠ sources differ — TRY: 27.21 mm²/mg · LEDA: 16.65 mm²/mg · GIFT: 21.78 mm²/mg
Temperature min-23 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound12 000 per lb
ToxicityNone
Veneer productNo
Other traits11
Diaspore typefruit with appendage
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Leaf marginentire
Leaf spinesno
Leaf thornsno
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition39 compounds
Compounds documented for Avena fatua across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aporphine alkaloids $ Isoquinoline alkaloids13
Cinnamic acid amides5
Oleanane triterpenoids4
Bisabolane sesquiterpenoids4
Aporphine alkaloids3
Documented compounds39 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Dicentrine | present | NPASS | |
| (12R)-17-methoxy-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaen-18-ol | present | NPASS | |
| (E)-1-[(12R,13R)-13-hydroxy-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaen-11-yl]but-2-en-1-one | present | NPASS | |
| (R)-beta-bisabolene | present | LOTUS | |
| (Z)-Lanceol | present | LOTUS | |
| 1-[(12R,13R)-13-hydroxy-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaen-11-yl]butan-1-one | present | NPASS | |
| 1-[(6aS)-1-hydroxy-2-methoxy-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-6-yl]butan-1-one | present | NPASS | |
| 1-[(6aS)-1-hydroxy-2-methoxy-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-6-yl]ethanone | present | NPASS | |
| 1-[(6aS)-1-hydroxy-2-methoxy-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-6-yl]propan-1-one | present | NPASS | |
| 16-Hydroxy-15-methoxy-10-azatetracyclo[7.7.1.02,7.013,17]heptadeca-1(17),2,4,6,8,13,15-heptaene-10-carbaldehyde | present | NPASS |
05DNA & barcoding87 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Avena fatua has left across the world's sequence archives.
At a glance
DNA specimens87
Marker genes13
GenBank sequences10
eDNA detections63
Countries12
The DNA barcodea real sequence read deposited for this species
CGCTAAACACGCTCCCAACCCCTTACGGGGGAACAGGATGCGGCATTTGGCTCCCCGTCACCCAAGGGCGGTGGGCCGAAGATATGGCTG …
Avena fatua voucher ZX-12212 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL1★rbcLa★trnL-F★ITS7★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Avena fatua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size13 254 345 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Avena fatua13.25 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidy6× hexaploid · measured
Chromosome records14–482n range42median42mode87records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4280×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CONTE L., CRISTOFOLINI G., BONOMO M.C. - 1995. Biosistematica del genere avena L. (Poaceae): Analisi della rubisco nelle specie poliploidi.. Giorn. Bot. Ital. , 129(2): 40.
CCDB · ita-fl — MARTINOLI G. - 1955. Citotassonomia di alcune specie del genere Avena della Sardegna.. Caryologia , 7(1): 191-204.
CCDB · slov-fl — Váchová M. & Májovský J., 1980: [Report], pp. 720-721. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4519
CCDB · poland — Pogan E., Czapik R., Jankun A., Kuta E. et al. 1982 a. Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov. Ser. Bot. 24, 91-126.
CCDB · poland — Mizianty M., Mirek Z. and Frey L. 1983. Chromosome numbers of Polish vascular plants (Part 4). Acta Soc. Bot. Pol. 52, 205-214.
CCDB · mediterranean
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1983. Chromosome numbers in Adoxaceae, Chloranthaceae, Cupressaceae, Juncaceae, Poaceae. Bot. Zhurn. SSSR 68 (12): 1683.
CCDB · ipcn-api-dl — Mizianty, M., Z. Mirek & L. Frey. 1983. Chromosome numbers of Polish vascular plants (Part 4). Acta Soc. Bot. Poloniae 52: 205–214.
CCDB · ipcn-api-dl — Bir, S. S. & H. S. Chauhan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 147–148.
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Nazarova, E. & A. Goukasian. 1995. Mediterranean chromosome number reports 5 (528--542). Fl. Medit. 5: 340–345.
CCDB · ipcn-api-dl — Yu, M. q., X. r. Ma & Q. q. Zhang. 1995. Karyotype study on three oats in China. J. Wuhan Bot. Res. 13(2): 177–179.
CCDB · ipcn-api-dl — Xu, R. h. & Q. q. Zhang. 1996. Karyotype analysis of hybrid between Chinese Spring and Avena fatua L. SouthW. China J. Agric. Sci. 9(1): 33–38.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Li, H. b., S. b. Zhong & J. x. Yao. 1998. Analysis of karyotype and C-banding pattern of the hexaploid oat (Avena fatua). J. Jiangsu Agric. Coll. 19(2): 35–38.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Vachova, M. & J. Majovsky. 1980. In Chromosome number reports LXIX. Taxon 29: 720–721.
CCDB · ipcn-api-dl — Bullen, M. R. & H. Rees. 1972. Nuclear variation within Aveneae. Chromosoma 39: 93– 100.
CCDB · ipcn-api-dl — Huss, H. 1980. Karyological studies on Avena hybrida from the Wakhan of Northeastern Afghanistan. Canad. J. Genet. Cytol. 22: 421–426.
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-ipcn75-78 — Nishiyama & Yabuno 1978
CCDB · book-northern-plants — Nishiyama 1939.
CCDB · book-indian_vol2 — Kihara, H. 1919b, 1924 ; Huskins, C.L. 1926, 1927 ; Nishiyama, I. 1929; Emme, H.K. (Fedorov) ; Philp, J. 1938 ; Shepeleva, Y.M. (Fedorov) ; Martinoli, G. 1955b ; Nakao, S. & Mori, S. 1956 ; Rajhathy, T. & Morrison, J.W. 1959 ; Mehra, P.N. et al. 1968 ; Faruqi, S.A. & Quraish, H .:B. 1979 ; vachova, M. & Majov- sky, J. 1980
CCDB · book-indian_vol2 — Gould, F.W. 1968
CCDB · eflora
CCDB · book-atlas-flowering-plants
CCDB · kew — Bullen MR, Rees H. 1972. Nuclear variation within Avenae. Chromosoma 39: 93-100.
CCDB · Cave1956supp — Martinoli 1955b
CCDB · Cave1959 — Rajh. & Morris. 1959a
CCDB · CromoCat 2015 — Dempsey, R. E., Gornall, R. J. & Bailey, J. P. (1994). Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63-66.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
CCDB · CromoCat 2015 — Li, H.-b., Zhong, S.-b. & Yao, J.-x. (1998). Analysis of karyotype and C-banding pattern of the hexaploid oat (Avena fatua) Journal of Jiangsu Agricultural College 19(2): 35-38
+35 more references
2n 144×CCDB · ipcn-api-dl · CCDB · kew · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Rodionov, A.V., E. O. Punina, M. A. Dobroradova, N. B. Tyupa & N. N. Nosov. 2006. Caryological study of the grasses (Poaceae): chromosome numbers of some Aveneae, Poeae, Phalarideae, Phleeae, Bromeae, Triticeae. Bot. Žhurn. (Moscow & Leningrad) 91(4): 615–627.
CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1973). Cytological investigations on W. Himalayan Pooideae. Cytologia 38: 237-258.
2n 282×CCDB · book-indian_vol2 · CCDB · iapt
CCDB · book-indian_vol2 — Mehra, P.N. et al, 1968
CCDB · iapt — IAPT/IOPB Chromosome Data 31
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, H, Gupta, R. C & Kumari, S. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1789
2n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Spies, J.J., S.K.Spies, S.M.C. Van Wyk, A.F. Malan & E.J.L. Liebenberg (1996a). Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 1. The tribe Aveneae, subtribes Aveninae Bothalia 26(1):53-61
2n 481×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Nikolaeva, A.G. (Fedorov)
n 2110×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — Bir, S. S. & C. Singh. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 60–61.
CCDB · ipcn-api-dl — Bir, S. S. & H. S. Chauhan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 147–148.
CCDB · ipcn-api-dl — Spies, J. J., S. K. Spies, S. M. C. v. Wyk, A. F. Malan & E. J. L. Liebenberg. 1996. Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 1. The tribe Aveneae, subtribe Aveninae. Bothalia 26(1): 53–61.
CCDB · ipcn-api-dl — Spies, J. J., S. K. Spies, S. M. C. v. Wyk, A. F. Malan & E. J. L. Liebenberg. 1996. Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 1. The tribe Aveneae, subtribe Aveninae. Bothalia 26: 53–61.
CCDB · ipcn-api-dl — Vachova, M. & J. Majovsky. 1980. In Chromosome number reports LXIX. Taxon 29: 720–721.
CCDB · ipcn-api-dl — Bullen, M. R. & H. Rees. 1972. Nuclear variation within Aveneae. Chromosoma 39: 93– 100.
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990a). SOCGI plant chromosome number reports-X J. Cytol. Genet. 25:147-148
CCDB · CromoCat 2015 — Spies, J.J., S.K.Spies, S.M.C. Van Wyk, A.F. Malan & E.J.L. Liebenberg (1996a). Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 1. The tribe Aveneae, subtribes Aveninae Bothalia 26(1):53-61
n 71×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1973). Cytological investigations on W. Himalayan Pooideae. Cytologia 38: 237-258.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type126 228 records
Wild obs. + sensor101 409
Museum / vouchered9 874
Cultivated / captive77
Other14 868
Origin
Native10 047
Introduced14 611
Range
Area of Occupancy AOO227 916 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy37% within 1 km
≤100 m 16 161≤1 km 15 022≤10 km 53 092>10 km 833
85 108 georeferenced · 16 301 without coordinates
Open the mapobservation + sensor101 409
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 618≤1 km 1 682≤10 km 2 458>10 km 543
5 301 georeferenced · 4 573 without coordinates
Open the institutions mapphysical evidence9 874
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 14>10 km 13
27 georeferenced · 50 without coordinates
Open the mapnot free-living77
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions246 of 438 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 588 |
| BFLlocation not on record | 418 |
| Helsinki, FI | 318 |
| LDlocation not on record | 243 |
| BIO-UNIPIlocation not on record | 213 |
| San Diego, US | 198 |
| Claremont, US | 156 |
| Moscow State Universitylocation not on record | 150 |
| Sanda, JP | 143 |
| MeiseBGlocation not on record | 143 |
| Olocation not on record | 137 |
| Uppsala, SE | 130 |
| SLU Artdatabankenlocation not on record | 125 |
| Davis, US | 124 |
| Riverside, US | 119 |
| ASUlocation not on record | 104 |
| Adelaide, AU | 103 |
| Santa Barbara, US | 101 |
| Beijing, CN | 100 |
| Québec, CA | 95 |
| Adam Mickiewicz University in Poznańlocation not on record | 89 |
| US | 86 |
| Provincia di Livornolocation not on record | 81 |
| Görlitz, DE | 73 |
| Bern, CH | 67 |
| Odawara, JP | 67 |
| San Luis Obispo, US | 65 |
| Tartu, EE | 64 |
| Mount Annan, AU | 63 |
| Museo Entomologico de Leonlocation not on record | 62 |
| Canberra, AU | 61 |
| Turku, FI | 60 |
| Oskarshamn, SE | 59 |
| Canadian Department of Agriculturelocation not on record | 58 |
| Flagstaff, US | 56 |
| Oulu, FI | 54 |
| Trondheim, NO | 53 |
| WTUlocation not on record | 52 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 51 |
| Mexico City, MX | 49 |
| Austin, US | 47 |
| Yangling, CN | 46 |
| Kensington, AU | 45 |
| Phoenix, US | 43 |
| Bronx, US | 43 |
| GJOlocation not on record | 41 |
| Pullman, US | 40 |
| Durango, MX | 40 |
| Auckland, NZ | 39 |
| Brisbane, AU | 39 |
| Salzburg, AT | 36 |
| CASlocation not on record | 36 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Chengdu, CN | 35 |
| Saint Louis, US | 34 |
| Bando, JP | 34 |
| Logan, US | 33 |
| Chiba, JP | 32 |
| Arcata, US | 32 |
| SXTCMlocation not on record | 30 |
| Philadelphia, US | 30 |
| Fort Worth, US | 30 |
| South Kensington, GB | 28 |
| Tokushima, JP | 27 |
| Christchurch, NZ | 27 |
| Tallinn, EE | 26 |
| Berlin, DE | 26 |
| GMBAlocation not on record | 26 |
| Bergen, NO | 26 |
| Seoul, KR | 26 |
| Corvallis, US | 26 |
| Wuzhou, CN | 25 |
| EL PASO, US | 24 |
| Kuopio, FI | 24 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 23 |
| BRNUlocation not on record | 23 |
| Chengdu, CN | 23 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 23 |
| Los Angeles, US | 22 |
| St. Paul, US | 22 |
| Dresden, DE | 21 |
| San Isidro, AR | 21 |
| Kochi, JP | 21 |
| Xiamen, CN | 21 |
| Kunming, CN | 21 |
| NSMKlocation not on record | 20 |
| QAUlocation not on record | 20 |
| Chongqing Museumlocation not on record | 20 |
| Pretoria, ZA | 19 |
| DBF-NHMDlocation not on record | 19 |
| Nanjing, CN | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Hobart, AU | 19 |
| Tsukuba, JP | 19 |
| Hiratsuka City Museumlocation not on record | 19 |
| Victoria, CA | 18 |
| Guangzhou, CN | 18 |
| Moscow, US | 18 |
| Irvine, US | 17 |
| Zürich, CH | 17 |
| CJBGlocation not on record | 17 |
| Montecillo, Texcoco, MX | 17 |
| Mexico City, MX | 17 |
| Cape Town, ZA | 17 |
| Spearfish, US | 16 |
| Toyama, JP | 16 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 16 |
| University of Stellenboschlocation not on record | 16 |
| Tomioka, JP | 16 |
| Wlocation not on record | 16 |
| Armidale, AU | 15 |
| Zapopan, MX | 15 |
| Urumqi, CN | 15 |
| Nagatoro-machi, Chichibu-gun, JP | 15 |
| Awka, NG | 15 |
| Nishihara, JP | 14 |
| Palmerston, AU | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 14 |
| Severin-McDaniel Insect Collectionlocation not on record | 14 |
| Córdoba, AR | 14 |
| Vancouver, CA | 13 |
| Bloomington, US | 13 |
| Kew, GB | 13 |
| PRClocation not on record | 13 |
| Mlocation not on record | 13 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| València, ES | 12 |
| Bozeman, US | 12 |
| Hermosillo, MX | 12 |
| BClocation not on record | 11 |
| Shanghai, CN | 11 |
| Fredericton Stock Culture Collectionlocation not on record | 11 |
| UGentlocation not on record | 11 |
| BAYLUlocation not on record | 11 |
| Northridge, US | 11 |
| Missoula, US | 10 |
| KIWElocation not on record | 10 |
| Karlsruhe, DE | 10 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 10 |
| Hazara Universitylocation not on record | 10 |
| Université Lavallocation not on record | 10 |
| Entomological Society of Latvialocation not on record | 10 |
| International Salmonella Centre (W.H.O.)location not on record | 10 |
| Angwin, US | 10 |
| Juriquilla, MX | 9 |
| Pocatello, US | 9 |
| Uniwersytet Jagiellońskilocation not on record | 9 |
| Zürich, CH | 9 |
| KOMlocation not on record | 9 |
| Denver, US | 9 |
| Aarhus, DK | 9 |
| Culiacán, MX | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| MAlocation not on record | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| University of Alberta Museumslocation not on record | 8 |
| Jiangxi College of Educationlocation not on record | 8 |
| Sagamihara, JP | 8 |
| Albuquerque, US | 8 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 8 |
| Turlock, US | 7 |
| BDBClocation not on record | 7 |
| Irkutsk State Universitylocation not on record | 7 |
| UIBlocation not on record | 7 |
| Wuhan, CN | 7 |
| San Angelo, US | 7 |
| Madison, US | 7 |
| TUR-Alocation not on record | 7 |
| POL003location not on record | 7 |
| UChlocation not on record | 7 |
| Puebla, MX | 7 |
| Ciudad de México, MX | 7 |
| Boise, US | 7 |
| Santa Cruz, US | 7 |
| Long Beach, US | 7 |
| Parkville, AU | 7 |
| Torreón, MX | 7 |
| Barcelona, ES | 7 |
| KMNlocation not on record | 6 |
| 盐城国家级珍禽自然保护区location not on record | 6 |
| New Haven, US | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Xining, CN | 6 |
| Hunan Hupingshan National Nature Reservelocation not on record | 6 |
| Chicago, US | 6 |
| IDElocation not on record | 6 |
| Frauenfeld, CH | 6 |
| University of New Hampshirelocation not on record | 6 |
| Ischia Marine Centrelocation not on record | 6 |
| Sendai, JP | 5 |
| Guasave, MX | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Tacoma, US | 5 |
| Ciudad Autónoma de Buenos Aires, AR | 5 |
| Catalina Island Conservancylocation not on record | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| Fukushima Universitylocation not on record | 5 |
| KURAlocation not on record | 5 |
| Uniwersytet Warszawskilocation not on record | 5 |
| Loja, EC | 5 |
| Alicante, ES | 5 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 5 |
| Vitoria, ES | 5 |
| Acadia Universitylocation not on record | 5 |
| Hangzhou, CN | 5 |
| Changsha, CN | 5 |
| Miami, US | 5 |
| Beijing Normal Universitylocation not on record | 5 |
| Muzaffarabad, PK | 5 |
| NSW Office of Environment and Heritagelocation not on record | 5 |
| J.F.Oberlin Universitylocation not on record | 5 |
| Ensenada, MX | 5 |
| Chengdu, CN | 5 |
| Chapingo, MX | 5 |
| Wellington, NZ | 5 |
| Urumqi, CN | 4 |
| Frankfurt am Main | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Zacatecas, MX | 4 |
| Paris, FR | 4 |
| CICYTEXlocation not on record | 4 |
| Tampa, US | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| nlocation not on record | 4 |
| Guilin, CN | 4 |
| Columbia, US | 4 |
| Ann Arbor, US | 4 |
| BSBIlocation not on record | 4 |
| Otaru, JP | 4 |
| San Bernardino, US | 4 |
| Edinburgh, GB | 4 |
| Ashland, US | 4 |
| Stephenville, US | 4 |
| Lausanne, CH | 4 |
| Portland, US | 4 |
| Cenargenlocation not on record | 4 |
| Montréal, CA | 4 |
| Jyväskylä, FI | 4 |
| HUN003location not on record | 4 |
| Dekalb, US | 4 |
| University of Winnipeglocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Denton, US | 4 |
| Brasília, BR | 4 |
| Chicago, US | 4 |
| Ixtacuixtla de Mariano Matamoros, MX | 4 |
| JBRJlocation not on record | 3 |
| Nishihara, JP | 3 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| Yunnan Universitylocation not on record | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Pamplona, ES | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Wollongong, AU | 3 |
| Clemson, US | 3 |
| JMSlocation not on record | 3 |
| Fayetteville, US | 3 |
| Stockholm, SE | 3 |
| Morelia, MX | 3 |
| Toronto, CA | 3 |
| Nijmegen, NL | 3 |
| Osaka, JP | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Fullerton, US | 3 |
| Madrid, ES | 3 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| KR | 3 |
| PUC-RSlocation not on record | 3 |
| Fulda, DE | 3 |
| Glarus, CH | 3 |
| Garðabær, IS | 3 |
| Cheney, US | 3 |
| Tula State Universitylocation not on record | 3 |
| Pamplona, ES | 3 |
| Tuscaloosa, US | 3 |
| Porrentruy, CH | 3 |
| USFSlocation not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Kushiro City Museumlocation not on record | 3 |
| Shinshu Universitylocation not on record | 3 |
| Ciudad Juárez, MX | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| La Paz, MX | 2 |
| Taipei, TW | 2 |
| San Jose, US | 2 |
| Sevilla, ES | 2 |
| Guiyang, CN | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| DULlocation not on record | 2 |
| Jackson, US | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| LfUlocation not on record | 2 |
| WINlocation not on record | 2 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 2 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 2 |
| La Trobe Universitylocation not on record | 2 |
| ENTClocation not on record | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| JP | 2 |
| Provo, US | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| KNFHClocation not on record | 2 |
| Coimbra, PT | 2 |
| Kagoshima, JP | 2 |
| SZUlocation not on record | 2 |
| Austin, US | 2 |
| Fargo, US | 2 |
| Castelar, AR | 2 |
| Forssa, FI | 2 |
| Chadron, US | 2 |
| Bourges, FR | 2 |
| Caldwell, US | 2 |
| Guatemala City, GT | 2 |
| ROM007location not on record | 2 |
| AZE003location not on record | 2 |
| Porvoo, FI | 2 |
| Granada, ES | 2 |
| TAIElocation not on record | 2 |
| Bangkok, TH | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| TROMlocation not on record | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Mexico City, MX | 2 |
| Brussel, BE | 2 |
| Calabar, NG | 2 |
| National Museum Waleslocation not on record | 2 |
| Beijing Natural History Museumlocation not on record | 2 |
| Henderson, US | 2 |
| The University of Arizonalocation not on record | 2 |
| College Park, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Whitehorse, CA | 1 |
| Peking Universitylocation not on record | 1 |
| LINUlocation not on record | 1 |
| Anchorage, US | 1 |
| AUT001location not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Mississippi State, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| SIHUlocation not on record | 1 |
| KNFSClocation not on record | 1 |
| Burlington, US | 1 |
| Bratislava, SK | 1 |
| Joondalup, AU | 1 |
| AASlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Mérida, MX | 1 |
| Davenport, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Sion, CH | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Pittsburg, US | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Rotorua, NZ | 1 |
| AUAlocation not on record | 1 |
| nbflocation not on record | 1 |
| San Francisco, US | 1 |
| Minia, EG | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Batemans Bay, AU | 1 |
| PrivatHerblocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| DNSMlocation not on record | 1 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 1 |
| Quito, EC | 1 |
| Tapachula, MX | 1 |
| PHlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Salamanca, ES | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Buenos Aires, AR | 1 |
| Cape Town, ZA | 1 |
| MEXUlocation not on record | 1 |
| La Paz, BO | 1 |
| BioFokuslocation not on record | 1 |
| KMCClocation not on record | 1 |
| National Tropical Botanical Gardenlocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Bend, US | 1 |
| Philadelphia, US | 1 |
| Yerevan, AM | 1 |
| Namur, BE | 1 |
| Portland, US | 1 |
| UFSClocation not on record | 1 |
| GZUlocation not on record | 1 |
| BACFlocation not on record | 1 |
| BGPAlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Gijón, ES | 1 |
| Universität Göttingenlocation not on record | 1 |
| OLAlocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Badajoz, ES | 1 |
| Dhaka, BD | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Baroda, IN | 1 |
| South China Normal Universitylocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Academia de Ciencias de Cuba, Instituto de Zoologialocation not on record | 1 |
| Winterthur, CH | 1 |
| Shanghai, CN | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Jinghong, CN | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Tilburg, NL | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| New Brunswick, US | 1 |
| LPMMBHlocation not on record | 1 |
| Xian, CN | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Zhengzhou, CN | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Staten Island, US | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Shenzhen, CN | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Lincoln, US | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
438 institutions · 9 111 of 9 874 vouchered records shown · 667 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA63 detections
Where the DNA of Avena fatua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found63
Studies independent surveys2
Countries11
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 63 detections have coordinates
Open the map11 countries0
Coastal Sage Scrub/Riparian with Malosma lau…grassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 10.4–18.5
Seasonal swing summer↔winter15.6 °C
Max temp (day)16.4 °C 13.8–24.1
Min temp (night)7.60 °C 7.40–13.7
Precipitation88.7 mm/mo 59.3–112
Air humidity62.4 % 56.8–65.3
Moisture balance21.7 mm/mo -68.8–38.4
Vapour deficit595 Pa 437–919
Wind speed3.70 m/s 2.50–3.90
Cloud cover44.8 % 34.2–52.4
CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.