Autosticha kyotensis

Matsumura, 1931 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Autostichidae/Autosticha

At a glance

Occurrence records436

Data sources6

Biological traits0

DNA specimens22

eDNA detections18

Sources6 archives

Databases and archives Autosticha kyotensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility436 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF436 records

Environmental DNA1 datasets · 3 countries18 detections

DNA & barcodingBOLD22 specimens

01Narrative

Autosticha kyotensis, the Kyoto moth, is a moth in the family Autostichidae. It was described by Shōnen Matsumura in 1931. It is found in Japan on the island of Honshu. It is an introduced species in the United States, where it has been recorded from Alabama, Florida, Louisiana, Mississippi, North Carolina, Tennessee and Texas. The wingspan is 15–19 mm. Adults look similar to Autosticha lushanensis.Park, K. T. & Wu, C. S. (2003). "A revision of the genus Autosticha Meyrick (Lepidoptera: Oecophoridae) in Eastern Asia". Insecta Koreana. 20 (2): 195-225. The larvae feed on Cedrus deodara and Prunus mume.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Autosticha kyotensis has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections18

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

106Tvariable

157Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes3

BIN1

Most divergent pair0.30%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paramaxates posterectasame order8.5%Paramaxates taiwanasame order8.6%Xylorycta aphelessame order8.7%Pardasena virgulanasame order8.8%Psilocorsis cryptolechiellasame order9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type436 records

Wild obs. + sensor359

Museum / vouchered77

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 177≤1 km 49≤10 km 10>10 km 32

268 georeferenced · 91 without coordinates

Open the mapobservation + sensor359

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 28

28 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	37
Washington, US	21
Kawasaki Shi Tama Ku, JP	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Sagamihara, JP	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	3

6 institutions · 77 of 77 vouchered records shown

09Environmental DNA18 detections

Where the DNA of Autosticha kyotensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

found at 10:40pm and photographed by collector

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 22.0–27.1

Seasonal swing summer↔winter11.9 °C

Max temp (day)28.9 °C 24.5–31.8

Min temp (night)23.0 °C 19.0–23.7

Precipitation228 mm/mo 102–238

Air humidity61.6 % 57.7–68.6

Moisture balance73.2 mm/mo -60.4–102

Vapour deficit1,300 Pa 930–1,371

Wind speed2.70 m/s 2.10–4.50

Cloud cover32.8 % 30.0–41.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)