Autoplusia egena

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Autoplusia

At a glance

Occurrence records56

Data sources7

Biological traits0

DNA specimens12

eDNA detections16

Sources7 archives

Databases and archives Autoplusia egena's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 6 countries16 detections

DNA & barcodingBOLD12 specimens

01Narrative

The bean leafskeletonizer (Autoplusia egena) is a moth of the family Noctuidae. It is found in California, North Carolina to the South-eastern parts of the United States, the Antilles, Mexico, Central America and South America. The subspecies Autoplusia egena galapagensis is endemic to the Galapagos islands. Caterpillar The larvae feed on Amaryllidaceae, Apiaceae, Asteraceae, Boraginaceae, Brassicaceae, Fabaceae, Lamiaceae, Malvaceae, Ranunculaceae, Glycine max and Phaseolus vulgaris.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Autoplusia egena has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections16

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 3 variable positions, in barcode order

43Avariable

214Avariable

316Amostly conserved

TACTTTATATTTTATTTTTGGTATCTGAGCTGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGAACTCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Autoplusia egenoidessame genus4.0%Rachiplusia virgulasame family4.9%Rachiplusia ousame family5.3%Plusia masonisame family5.5%Rachiplusia nusame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type56 records

Wild obs. + sensor20

Museum / vouchered36

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 9≤1 km 4≤10 km 2>10 km 1

16 georeferenced · 4 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 4≤1 km 4≤10 km 8>10 km 11

27 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	16
New Haven, US	6
St. Paul, US	5
National Biodiversity Institute, Costa Ricalocation not on record	3
ASUlocation not on record	2
US	1
Ciudad de México, MX	1
Colorado State Universitylocation not on record	1
PUC-RSlocation not on record	1

9 institutions · 36 of 36 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Autoplusia egena was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map6 countries0

1. Forest & Woodland1. Forest & Woodland|1.6. Subtropical/Tropic…Forest3. Shrubland | 3.5. Subtropical/Tropical Dry…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 12.3–24.7

Seasonal swing summer↔winter1.30 °C

Max temp (day)22.4 °C 16.3–29.4

Min temp (night)18.4 °C 8.80–20.6

Precipitation87.9 mm/mo 35.5–271

Air humidity63.8 % 57.0–66.9

Moisture balance-16.0 mm/mo -113–163

Vapour deficit812 Pa 507–1,229

Wind speed3.40 m/s 0.8–5.80

Cloud cover33.3 % 17.8–67.8

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)