Automeris postalbida

Schaus, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Automeris

At a glance

Occurrence records444

Data sources7

Biological traits0

DNA specimens32

eDNA detections1

Sources7 archives

Databases and archives Automeris postalbida's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility444 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF444 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD32 specimens

01Narrative

Automeris postalbida is a moth of the family Saturniidae first described by William Schaus in 1900. It is found from Costa Rica to Ecuador.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Automeris postalbida has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

10Cmostly conserved

40Gmostly conserved

106Cmostly conserved

259Cmostly conserved

268Cmostly conserved

271Cmostly conserved

277Cmostly conserved

346Cmostly conserved

380Gmostly conserved

401Tmostly conserved

433Amostly conserved

451Cmostly conserved

487Cmostly conserved

500Tmostly conserved

532Cmostly conserved

544Cmostly conserved

580Amostly conserved

613Cmostly conserved

640Cmostly conserved

646Cmostly conserved

AACTTTATACTTTATTTTCGGAATTTGAGCTGGAATAGTGGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAACCCCCAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes5

BINs2

Most divergent pair7.6%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Automeris anikmeisteraesame genus3.0%Automeris vanschayckisame genus3.2%Automeris silkaesame genus6.1%Automeris tatiaesame genus6.4%Automeris yarumalasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type444 records

Wild obs. + sensor239

Museum / vouchered205

Origin

Native4

Range

Area of Occupancy AOO648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 122≤1 km 47≤10 km 22>10 km 13

204 georeferenced · 35 without coordinates

Open the mapobservation + sensor239

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	190
University of Pennsylvanialocation not on record	10
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Denver, US	1
Smithsonian Tropical Research Institutelocation not on record	1

6 institutions · 205 of 205 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Automeris postalbida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 23.9–23.9

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.7 °C

Min temp (night)21.8 °C

Precipitation478 mm/mo

Air humidity74.7 %

Moisture balance344 mm/mo

Vapour deficit748 Pa

Wind speed1.00 m/s

Cloud cover42.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)