Austrostipa hemipogon

(Benth.) S.W.L.Jacobs & J.Everett · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Austrostipa

At a glance

Occurrence records1 549

Data sources7

Biological traits28

DNA specimens7

eDNA detections5

Sources7 archives

Databases and archives Austrostipa hemipogon's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 549 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF1 549 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Austrostipa hemipogon is a tufted, perennial grass (a member of the family Poaceae. It is native to Australia, and found in Western Australia, South Australia, Victoria, and Tasmania. It was first described as Stipa hemipogon by George Bentham in 1878 from a specimen collected in Western Australia by James Drummond and in 1996 was transferred to the genus, Austrostipa, by Surrey Jacobs and Joy Everett.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length200 mm

Leaf width3 mm

Plant height1 m

Plant height max1 m

Plant height min0.3 m

Seed length3.5 mm

Life cycle & reproduction9

Dispersal typeanimal

Flowering timeynnnnnnyyyyy

Life formperennial or annual

Life spanperennial

Lifeform raunkiaer detailedhemicryptophyte

Lifespan years6 years

Pollination syndromeself+wind

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austrostipa hemipogon has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLN832418.1 ↗575 bpAustralia

ACGT

TGACAAATAGACCGTGCACAGTTATCCATCCTGCCGATGGCGGCACTGCTCGCCATTCGGCCAAGTCCCTGACCACCTCCCCTCCTCGGA …

Austrostipa hemipogon genomic DNA sequence contains ITS1, 5.8S rRNA gene and ITS2, specimen voucher MSB 0359502

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★rbcLa★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 549 records

Wild obs. + sensor661

Museum / vouchered887

Cultivated / captive1

Origin

Native654

Range

Area of Occupancy AOO4 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 450≤1 km 120≤10 km 55>10 km 7

632 georeferenced · 29 without coordinates

Open the mapobservation + sensor661

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 473≤1 km 136≤10 km 182>10 km 30

821 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence887

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	304
Kensington, AU	261
Canberra, AU	44
Mount Annan, AU	24
Museo Entomologico de Leonlocation not on record	23
Parkville, AU	14
Brisbane, AU	11
Palmerston, AU	3
National Herbarium of Victorialocation not on record	2
BGPAlocation not on record	2
Logan, US	1
Hobart, AU	1

12 institutions · 690 of 887 vouchered records shown · 195 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Austrostipa hemipogon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 19.6–21.9

Seasonal swing summer↔winter16.2 °C

Max temp (day)27.7 °C 26.2–28.5

Min temp (night)14.4 °C 13.2–15.0

Precipitation17.5 mm/mo 15.6–23.9

Air humidity46.1 % 43.4–52.4

Moisture balance-143 mm/mo -153–-140

Vapour deficit1,397 Pa 1,091–1,624

Wind speed4.00 m/s 4.00–4.40

Cloud cover18.1 % 17.3–19.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Austrostipa hemipogon

At a glance

Sources7 archives

Size & morphology6

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Record type1 549 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 549 records