Austromyrtus glabra

N.Snow & Guymer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Austromyrtus

At a glance

Occurrence records113

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Austromyrtus glabra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility113 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources13 traits

Occurrence & distributionGBIF113 records

DNA & barcodingNCBIsequences

01Narrative

Austromyrtus glabra is a species of plant in the Myrtaceae family that is native to south-east Queensland. Austromyrtus glabra grows to a height of . Leaves are opposite, aromatic when crushed, long and do not have hairs on the underside of the leaf unlike the related A. dulcis. It has white flowers that measure about in size and appear in spring and summer. The berry is in size and are edible. It can be found growing in eucalypt forests and on rocky soils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology1

Seed mass2.62 mg

Life cycle & reproduction4

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austromyrtus glabra has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKX522581.1 ↗845 bp

ACGT

CGTCCGTGAAAGTTTCCGGACGGGAAGCGGAGAGTGGGCGGTTCGCCGCCGATGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGA …

Austromyrtus glabra voucher J. Halford 792 (BRI) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type113 records

Wild obs. + sensor49

Museum / vouchered59

Cultivated / captive1

Other4

Origin

Native6

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 46≤1 km 1≤10 km 1

48 georeferenced · 1 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 8≤1 km 4≤10 km 18>10 km 4

34 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence59

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	23
Mount Annan, AU	6
Museo Entomologico de Leonlocation not on record	4
Canberra, AU	4
Armidale, AU	2
Adelaide, AU	2
Palmerston, AU	2
Bronx, US	1
Cambridge, US	1
Berlin, DE	1
Llocation not on record	1
CSIROlocation not on record	1
Kew, GB	1
Uppsala, SE	1
DOI/NPS, Greenbelt Parklocation not on record	1
Singapore Botanic Gardenslocation not on record	1
PNHlocation not on record	1
JEPSlocation not on record	1
Saint Louis, US	1
Honolulu, US	1

20 institutions · 56 of 59 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)