Austrocylindropuntia vestita

(Salm-Dyck) Backeb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Austrocylindropuntia

At a glance

Occurrence records83

Data sources8

Biological traits12

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Austrocylindropuntia vestita's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF83 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Austrocylindropuntia vestita ist eine Pflanzenart in der Gattung Austrocylindropuntia aus der Familie der Kakteengewächse (Cactaceae). Das Artepitheton vestita leitet sich vom lateinischen Wort vestitus für ‚bekleidet‘ ab und verweist auf die mit Haaren bedeckten Triebe der Art.Urs Eggli, Leonard E. Newton: Etymological Dictionary of Succulent Plant Names. Springer, Berlin/Heidelberg 2010, ISBN 978-3-642-05597-3, S. 251.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsucculent shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max3 000 m

Elevation min1 500 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austrocylindropuntia vestita has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences4

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHQ872511.1 ↗577 bp

ACGT

TCGAAACCTCCCCAGCAGAAAGACCCGCGAACTTGTTTCCCATGAACACGCGGGGAGGGGCGCCTTTGCCCCCCTCCCTGGCGCAACAAC …

Austrocylindropuntia vestita voucher Nursery acquired plant (RNG) internal transcribed spacer 1, partial sequence; and 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type83 records

Wild obs. + sensor76

Museum / vouchered7

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 38≤1 km 12≤10 km 10>10 km 4

64 georeferenced · 12 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Isidro, AR	2
Santa Cruz de la Sierra, BO	2
Saint Louis, US	1

3 institutions · 5 of 7 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Austrocylindropuntia vestita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 11.5–22.7

Seasonal swing summer↔winter8.00 °C

Max temp (day)19.8 °C 13.4–26.2

Min temp (night)14.2 °C 9.10–19.3

Precipitation132 mm/mo 101–163

Air humidity64.2 % 63.6–64.8

Moisture balance36.2 mm/mo 25.1–47.2

Vapour deficit759 Pa 527–991

Wind speed3.00 m/s 1.60–4.40

Cloud cover49.4 % 48.9–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)