Austrocylindropuntia subulata

(Muehlenpf.) Backeb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Austrocylindropuntia

At a glance

Occurrence records4 857

Data sources11

Biological traits40

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Austrocylindropuntia subulata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 857 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF4 857 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 66

01Narrative

Austrocylindropuntia subulata is a species of cactus native to the Peruvian Andes. The Latin specific epithet subulata means "awl-like", referring to the shape of the rudimentary leaves.Urs Eggli, Leonard E. Newton: Etymological Dictionary of Succulent Plant Names. Springer, Berlin/Heidelberg 2010, , S. 233. It is also known by its common names as Eve's pin and Eve's needle.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology15

Fruit length75 mm

Fruit length max80 mm

Fruit length min70 mm

Fruit width37.5 mm

Fruit width max40 mm

Fruit width min30 mm

Leaf length85 mm

Leaf length max12 mm

Leaf width5.25 mm

Leaf width max5 mm

Plant height4 m

Plant height max5 m

Plant height min1 m

Seed length7.25 mm

Seed width7.25 mm

Life cycle & reproduction9

Flower colourred

Flower length max80 mm

Flower length min60 mm

Flower width max50 mm

Flower width min35 mm

Flowering endJun

Flowering startApr

Life formsucculent shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max2 900 m

Elevation min0 m

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Leaf compoundnesssimple

Leaf shapesubulate

Woodinesswoody

Other traits4

Dbh max10 cm

Dbh min6 cm

Defenseyes

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austrocylindropuntia subulata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

rbcLAY875235.1 ↗1 425 bp

ACGT

GACTTATTATACTCCCGAATATCAACCCCAGGATACCGATATCTTGGCAGCATTCCGAGTAACCCCTCAACCTGGAGTTCCGTCAGAAGA …

Austrocylindropuntia subulata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Austrocylindropuntia subulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 66 n = 33

Ploidypolyploid inferred

Chromosome records66–662n range66median66mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 663×CCDB · book-ipcn73-74 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn73-74 — YUASA, H., H. SHIMIZU, S. KASHIWAI, & N. KONDO. 1974. Chromosome numbers and their bearing on the geographic distribution in the subfamily Opuntioideae (Cactaceae). Rep. Inst. Breed. Research, Tokyo Univ. Agri. No. 4: 1-10.

CCDB · book-fedorov — Katagiri 1953

CCDB · book-atlas-flowering-plants — Katagiri 1952

2n 1211×CCDB · book-ipcn73-74

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 857 records

Wild obs. + sensor4 701

Museum / vouchered90

Cultivated / captive1

Other65

Origin

Native1

Introduced1 403

Range

Area of Occupancy AOO10 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 1 717≤1 km 1 196≤10 km 743>10 km 86

3 742 georeferenced · 959 without coordinates

Open the mapobservation + sensor4 701

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 4≤1 km 10≤10 km 7>10 km 5

26 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence90

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	22
ASUlocation not on record	8
Adelaide, AU	7
Saint Louis, US	5
Phoenix, US	5
Riverside, US	4
Christchurch, NZ	3
València, ES	2
Badajoz, ES	2
La Paz, BO	2
Museo Entomologico de Leonlocation not on record	2
Claremont, US	2
San Diego, US	2
Kensington, AU	2
Phyletisches Museum Jenalocation not on record	2
San Luis Obispo, US	1
CJBGlocation not on record	1
Brisbane, AU	1
Chongqing Museumlocation not on record	1
MAlocation not on record	1
Antiguo Cuscatlán, SV	1
MEXUlocation not on record	1
Mount Annan, AU	1
San Isidro, AR	1
Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record	1
Universidad de Antioquia (UdeA)location not on record	1
CICYTEXlocation not on record	1
Jardín Botánico José Celestino Mutis (JBBJCM)location not on record	1
Berlin, DE	1
Pretoria, ZA	1
PALlocation not on record	1
BDBClocation not on record	1
Córdoba, ES	1

33 institutions · 88 of 90 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Austrocylindropuntia subulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Austrocylindropuntia subulata

At a glance

Sources11 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Other traits4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 857 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 33 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 857 records