Austrocylindropuntia cylindrica

(Lam.) Backeb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Austrocylindropuntia

At a glance

Occurrence records1 183

Data sources13

Biological traits33

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Austrocylindropuntia cylindrica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Chemical compositionLOTUS · NPASS13 compounds

Occurrence & distributionGBIF1 183 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 110

01Narrative

Austrocylindropuntia cylindrica (syn. Opuntia cylindrica), the cane cactus, is a species of flowering plant in the family Cactaceae. It is native to Colombia, Ecuador, and Peru, and it has been introduced to the Canary Islands, Morocco, Eritrea, Ethiopia, South Africa, Australia, and New Zealand. A popular ornamental, it is an invasive species in Europe, South Africa, and Australia. Due to a misidentification, for a time this species was erroneously thought to contain mescaline.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology11

Fruit length50 mm

Fruit length max90 mm

Fruit width40 mm

Leaf length11.5 mm

Leaf length max13 mm

Leaf length min10 mm

Leaf width8.4 mm

Plant height3 m

Plant height max4 m

Plant height min1 m

Seed width5 mm

Life cycle & reproduction9

Flower colourred

Flower length max70 mm

Flower length min50 mm

Flower width max45 mm

Flower width min30 mm

Flowering endJun

Flowering startApr

Life formsucculent shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation mean2 600 m

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapelinear terete

Woodinesswoody

Other traits1

Defenseyes

03Chemical composition13 compounds

Compounds documented for Austrocylindropuntia cylindrica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenylethylamines5

Pyrroloquinoline alkaloids2

Neolignans2

Stigmastane steroids2

Monomeric stilbenes1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(6R,7aS)-7a-(2-methoxy-4-prop-2-enylphenoxy)-6-prop-2-enyl-6,7-dihydro-1,3-benzodioxol-5-one	present	NPASS
3-Methoxytyramine	present	LOTUS
4-(2-Aminoethyl)-2,6-dimethoxyphenol	present	LOTUS
5-(2-Aminoethyl)-3-methoxybenzene-1,2-diol	present	LOTUS
9-Methoxycamptothecin	present	NPASS
Camptothecin	present	NPASS
Didymochlaenone B	present	NPASS
Dopamine	present	LOTUS
Lawsaritol	present	NPASS
Mescaline	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austrocylindropuntia cylindrica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKFN997069.1 ↗2 424 bpUnited Kingdom

ACGT

TCGTCTACATCATCGGTAGAGTTTATCAGACCACGACTGATCCTGAAAGGAAATGAATGGAAAAAAGAGCATGTCGTATCAATCGAGAAT …

Austrocylindropuntia cylindrica chloroplast matK gene and partial tRNA-Lys intron, specimen voucher RNG AB8

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Austrocylindropuntia cylindrica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 110 n = 55

Ploidypolyploid inferred

Chromosome records44–1102n range110median110mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1103×CCDB · book-ipcn73-74 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn73-74 — YUASA, H., H. SHIMIZU, S. KASHIWAI, & N. KONDO. 1974. Chromosome numbers and their bearing on the geographic distribution in the subfamily Opuntioideae (Cactaceae). Rep. Inst. Breed. Research, Tokyo Univ. Agri. No. 4: 1-10.

CCDB · book-fedorov — Katagiri 1953

CCDB · book-atlas-flowering-plants — Katagiri 1952

2n 442×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bandyopadhyay, B. & A. Sharma. 2000. The use of multivariate analysis of karyotypes to determine relationships between species of Opuntia (Cactaceae). Caryologia 53: 121–126.

CCDB · ipcn-api-dl — Bandyopadhyay, B. 1997. Cytological studies on genus Opuntia (Cactaceae). Proc. Indian Sci. Congr. Assoc. 84(4A): 34.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 183 records

Wild obs. + sensor1 102

Museum / vouchered80

Cultivated / captive1

Origin

Native5

Introduced49

Range

Area of Occupancy AOO1 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 287≤1 km 160≤10 km 55>10 km 13

515 georeferenced · 587 without coordinates

Open the mapobservation + sensor1 102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 12≤1 km 15≤10 km 15>10 km 5

47 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence80

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	28
Museo Entomologico de Leonlocation not on record	7
Mount Annan, AU	7
Saint Louis, US	5
ASUlocation not on record	5
Canberra, AU	5
Phoenix, US	4
Jardín Botánico José Celestino Mutis (JBBJCM)location not on record	2
Stockholm, SE	2
Durban, ZA	2
San Luis Obispo, US	1
QCNElocation not on record	1
Universidad de Antioquia (UdeA)location not on record	1
BIO-UNIPIlocation not on record	1
Bronx, US	1
Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record	1
Aarhus, DK	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
MAlocation not on record	1
Loja, EC	1
Pretoria, ZA	1

21 institutions · 78 of 80 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Austrocylindropuntia cylindrica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–10.1

Seasonal swing summer↔winter10.7 °C

Max temp (day)11.8 °C

Min temp (night)7.90 °C

Precipitation93.6 mm/mo

Air humidity63.4 %

Moisture balance22.4 mm/mo

Vapour deficit469 Pa

Wind speed4.80 m/s

Cloud cover50.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Austrocylindropuntia cylindrica

At a glance

Sources13 archives

Size & morphology11

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Other traits1

Compound class profile5 classes

Documented compounds13 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 183 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 183 records