Austrocallerya pilipes

(F.M.Bailey) J.Compton & Schrire · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Austrocallerya

At a glance

Occurrence records98

Data sources6

Biological traits15

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Austrocallerya pilipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility98 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Occurrence & distributionGBIF98 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Austrocallerya pilipes là một loài thực vật có hoa trong họ Đậu. Năm 1890 Frederick Manson Bailey công bố mô tả khoa học cho danh pháp Millettia pilipes tại trang 108 của Second Addenda to Third Supplement of the Synopsis of the Queensland Flora. Năm 2019, James A. Compton và Brian D. Schrire thiết lập chi Austrocallerya và chuyển nó sang chi này.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraits

Size & morphology6

Fruit length215 mm

Fruit width34 mm

Leaf length70 mm

Leaf width35 mm

Seed length22 mm

Seed width23 mm

Life cycle & reproduction3

Flowering timennnnnnnnyyyn

Life formclimber

Life spanperennial

Habitat & environment6

Climatewet tropical

Fruit fleshinessdry

Fruit typelegume

Growth formclimber

Leaf compoundnesscompound

Woodinesswoody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austrocallerya pilipes has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences9

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK953953.1 ↗621 bp

ACGT

CGATGCCTTAAAAGCAATCCAACCCGTGAATCAGTTTGACTACACAAGGTTGGCCTCGAGGTGTTTTGGCACCTCAGCCTCCCTTGAGCT …

Austrocallerya pilipes internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type98 records

Wild obs. + sensor2

Museum / vouchered91

Cultivated / captive1

Other4

Origin

Native6

Introduced1

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy1% within 1 km

≤100 m 1≤10 km 89

90 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence91

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	52
Brisbane, AU	18
Mount Annan, AU	7
Museo Entomologico de Leonlocation not on record	6
Canberra, AU	5
Palmerston, AU	2

6 institutions · 90 of 91 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Austrocallerya pilipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)