Austrocallerya megasperma

(F.Muell.) J.Compton & Schrire · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Austrocallerya

At a glance

Occurrence records658

Data sources7

Biological traits30

DNA specimens8

eDNA detections7

Sources7 archives

Databases and archives Austrocallerya megasperma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility658 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF658 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Callerya megasperma, also known as native wisteria, is a species of vine in the family Fabaceae native to eastern Australia. It was initially described as Wistaria megasperma by Ferdinand von Mueller in 1859 from a specimen collected at Richmond River.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology12

Fruit length140 mm

Fruit width40 mm

Leaf length100 mm

Leaf length max300 mm

Leaf length min150 mm

Leaf mass per area46.95 g/m2

Leaf width32.5 mm

Leaf width max35 mm

Leaf width min20 mm

Petiole length5 cm

Seed length24 mm

Seed width18 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dehiscencedehiscent

Flowering timennnnnnnnyyyn

Life formliana

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: climber_woody · TRY: Lianas (wody climbers)

Leaf compoundnesscompound

Leaf shapeelliptical oblong obovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density425 mg/cm³

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austrocallerya megasperma has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes6

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK953951.1 ↗622 bp

ACGT

CGATGCCTTAAAAGCAATCCAACCCGTGAATCAGTTTGACTACACAAGGTTGGCTTGAGGTGTTTCGGCACCTCAACCTCCCTTGAGCTG …

Austrocallerya megasperma internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type658 records

Wild obs. + sensor401

Museum / vouchered137

Cultivated / captive1

Other119

Origin

Native42

Range

Area of Occupancy AOO1 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 303≤1 km 33≤10 km 11>10 km 15

362 georeferenced · 39 without coordinates

Open the mapobservation + sensor401

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 22≤1 km 22≤10 km 49>10 km 25

118 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence137

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	42
Brisbane, AU	41
Museo Entomologico de Leonlocation not on record	26
Canberra, AU	13
Armidale, AU	7
Smithfield, AU	5
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1

9 institutions · 137 of 137 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Austrocallerya megasperma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 20.7–20.7

Seasonal swing summer↔winter8.90 °C

Max temp (day)23.7 °C

Min temp (night)18.0 °C

Precipitation139 mm/mo

Air humidity58.8 %

Moisture balance16.6 mm/mo

Vapour deficit1,009 Pa

Wind speed2.50 m/s

Cloud cover25.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)