Austrocallerya australis

(Endl.) J.Compton & Schrire · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Austrocallerya

At a glance

Occurrence records239

Data sources6

Biological traits31

DNA specimens9

eDNA detections7

Sources6 archives

Databases and archives Austrocallerya australis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Austrocallerya australis là một loài thực vật có hoa trong họ Đậu. Loài này được Stephan Ladislaus Endlicher mô tả khoa học đầu tiên năm 1833 dưới danh pháp Pterocarpus australis. Năm 2019, James A. Compton và Brian D. Schrire thiết lập chi Austrocallerya và chuyển nó sang như là loài điển hình của chi này.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology13

Fruit length115 mm

Fruit width25 mm

Leaf length60 mm

Leaf length max200 mm

Leaf length min100 mm

Leaf mass per area68.03 g/m2

Leaf width18.5 mm

Leaf width max25 mm

Leaf width min10 mm

Petiole length4 cm

Seed length15 mm

Seed mass2 435 mg

Seed width15 mm

Life cycle & reproduction6

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeself

Flowering timennnnnyyyyyyn

Life formclimbing shrub or liana

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit typelegume

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: climber_herbaceous · TRY: climber

Habitat GIFTdry forest

Leaf compoundnesscompound

Leaf shapeoblong obovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austrocallerya australis has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes6

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN076207.1 ↗659 bp

ACGT

TCATTGTCGATGCCTTAAAAGCAATCCAACCCGTGAATCAGTTTGACTACACAAGGTTGGCTTGAGGTGTTTCGGCACCTCAACCTCCCT …

Austrocallerya australis isolate G07815 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★rbcL1★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type239 records

Wild obs. + sensor107

Museum / vouchered124

Cultivated / captive4

Other4

Origin

Native15

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 80≤1 km 15≤10 km 5>10 km 3

103 georeferenced · 4 without coordinates

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 29≤1 km 29≤10 km 56>10 km 5

119 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence124

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	35
Brisbane, AU	23
Canberra, AU	20
Mount Annan, AU	19
Museo Entomologico de Leonlocation not on record	11
NSW Dept of Planning, Industry and Environmentlocation not on record	10
Armidale, AU	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Hobart, AU	1

9 institutions · 124 of 124 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Austrocallerya australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 19.2–19.2

Seasonal swing summer↔winter9.40 °C

Max temp (day)22.8 °C

Min temp (night)16.0 °C

Precipitation138 mm/mo

Air humidity61.6 %

Moisture balance21.6 mm/mo

Vapour deficit856 Pa

Wind speed2.20 m/s

Cloud cover24.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)