Austrobuxus swainii

(Beuzev. & C.T.White) Airy Shaw · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Picrodendraceae/Austrobuxus

At a glance

Occurrence records717

Data sources7

Biological traits34

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Austrobuxus swainii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility717 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF717 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Austrobuxus swainii is a rare rainforest tree in the Picrodendraceae family. It is endemic to north east New South Wales and south eastern Queensland, Australia. Occurring from the Bellinger River in the south to Tallebudgera Creek in the north. The common names are pink cherry or hairybark. The habitat is less fertile sedimentary based soils, often associated with the Coachwood, in high rainfall areas. Listed on ROTAP, as a threatened species, with a rating of 3RCa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length13 mm

Leaf length105 mm

Leaf length max140 mm

Leaf length min70 mm

Leaf mass per area59.72 g/m2

Leaf width30 mm

Leaf width max40 mm

Leaf width min20 mm

Petiole length1 cm

Plant height40 m

Seed length5.5 mm

Seed width4.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscencedehiscent

Flowering timennnyyynnnnnn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_elliptical

Woodinesswoody

Physiology & chemistry3

Leaf n13.38 mg/g

Leaf p0.652 mg/g

Specific leaf area (SLA)17.26 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austrobuxus swainii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896126.1 ↗548 bpAustralia

ACGT

AAGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATATTGGCAGC …

Austrobuxus swainii voucher 1076418080 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type717 records

Wild obs. + sensor586

Museum / vouchered122

Cultivated / captive1

Other8

Origin

Native21

Introduced2

Range

Area of Occupancy AOO664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 538≤1 km 27≤10 km 3>10 km 4

572 georeferenced · 14 without coordinates

Open the mapobservation + sensor586

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 12≤1 km 29≤10 km 29>10 km 24

94 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence122

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	27
NSW Dept of Planning, Industry and Environmentlocation not on record	26
Mount Annan, AU	23
Armidale, AU	13
Smithfield, AU	12
Canberra, AU	11
Museo Entomologico de Leonlocation not on record	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Kew, GB	2
Davis, US	1

10 institutions · 121 of 122 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Austrobuxus swainii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 19.3–19.3

Seasonal swing summer↔winter9.90 °C

Max temp (day)23.5 °C

Min temp (night)15.6 °C

Precipitation128 mm/mo

Air humidity61.9 %

Moisture balance15.0 mm/mo

Vapour deficit865 Pa

Wind speed1.40 m/s

Cloud cover24.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)