Austroboletus lacunosus

(Kuntze) T.W.May & A.E.Wood · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Austroboletus

At a glance

Occurrence records406

Data sources6

Biological traits0

DNA specimens0

eDNA detections15

Sources6 archives

Databases and archives Austroboletus lacunosus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility406 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF406 records

Environmental DNA3 datasets · 2 countries15 detections

DNA & barcodingNCBIsequences

01Narrative

Austroboletus lacunosus is a bolete fungus native to Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austroboletus lacunosus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences9

eDNA detections15

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKP242177.1 ↗366 bpAustralia

ACGT

ACTGTAGATTATCTCCAAAAGAGTATCATCTATCCTTTTCTACATTATACCCCTTTTACATGCATGTCAATAGAATGGAATATATAAATC …

Austroboletus lacunosus voucher BRI:AQ796201 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type406 records

Wild obs. + sensor318

Museum / vouchered88

Range

Area of Occupancy AOO1 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 154≤1 km 78≤10 km 14>10 km 15

261 georeferenced · 57 without coordinates

Open the mapobservation + sensor318

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 32≤1 km 9≤10 km 18>10 km 3

62 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	29
Bronx, US	16
Museo Entomologico de Leonlocation not on record	14
Kensington, AU	12
Leicester, GB	7
Adelaide, AU	3
Canberra, AU	3
Hobart, AU	1
DPIlocation not on record	1

9 institutions · 86 of 88 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Austroboletus lacunosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys3

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH4.90 4.60–6.20

Conductivity30.0 µS/cm 23.0–89.0

Organic carbon0.98 % 0.83–5.22

Water content8.98 % 6.47–11.6

Nitrate-N15.0 mg/kg 7.00–18.0

Phosphorus84.0 mg/kg 32.0–136

Clay5.76 % 3.88–6.19

Sand94.2 % 93.8–96.1

Depth0 m 0–0.2

SoilPodosolFerrosol

5 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 10.7–12.6

Seasonal swing summer↔winter8.80 °C

Max temp (day)14.6 °C 14.6–16.9

Min temp (night)10.2 °C 5.40–10.2

Precipitation105 mm/mo 37.8–105

Air humidity56.5 % 54.6–56.5

Moisture balance22.7 mm/mo -38.1–22.7

Vapour deficit630 Pa 581–630

Wind speed5.30 m/s 1.80–5.30

Cloud cover21.6 % 17.7–21.6

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)