Austroboletus gracilis

(Peck) Wolfe · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Austroboletus

At a glance

Occurrence records693

Data sources10

Biological traits0

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Austroboletus gracilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility693 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.07 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF693 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT74 Mbp

01Narrative

Austroboletus gracilis is a species of bolete fungus in the family Boletaceae. Originally described as Boletus gracilis by Charles Horton Peck in 1872, it was transferred to the genus Austroboletus by Carl B. Wolfe in 1979.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Austroboletus gracilis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX652690.1 ↗704 bpUSA · 2024

ACGT

TCGATGCAAGAGCAAAGGGGGGAATGCGGGGGAGATTGTCGCTGGCAAGTTCTTGCTTGCATGTGCACGTCCCTTCGTCTACCTCTTTTG …

Austroboletus gracilis voucher HUH iNat#243887201 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Austroboletus gracilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size73 710 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Austroboletus gracilis0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type693 records

Wild obs. + sensor522

Museum / vouchered171

Range

Area of Occupancy AOO1 944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 156≤1 km 80≤10 km 108>10 km 52

396 georeferenced · 126 without coordinates

Open the mapobservation + sensor522

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 3≤1 km 25≤10 km 23>10 km 1

52 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	38
TENN-Flocation not on record	16
Davis and Elkins Collegelocation not on record	16
Chicago, US	16
Chiba, JP	14
Toronto, CA	13
Acadia Universitylocation not on record	8
Durham, US	7
Odawara, JP	7
Osaka, JP	6
Université de Montréal Biodiversity Centrelocation not on record	6
Royal Ontario Museum, TRTC Fungariumlocation not on record	4
Cincinnati, US	4
Tomioka, JP	3
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	2
CA	2
Ann Arbor, US	2
National Institute of Biological Resourceslocation not on record	2
Bando, JP	2
Ciudad de México, MX	1
National Biodiversity Institute, Costa Ricalocation not on record	1
Colorado State Universitylocation not on record	1

22 institutions · 171 of 171 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Austroboletus gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter27.5 °C

Max temp (day)12.5 °C

Min temp (night)3.30 °C

Precipitation69.3 mm/mo

Air humidity59.2 %

Moisture balance-8.50 mm/mo

Vapour deficit515 Pa

Wind speed3.70 m/s

Cloud cover51.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)