Australoporus tasmanicus

(Berk.) P.K.Buchanan & Ryvarden · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Polyporaceae/Australoporus

At a glance

Occurrence records784

Data sources6

Biological traits0

DNA specimens0

eDNA detections2

Sources6 archives

Databases and archives Australoporus tasmanicus's data was compiled from.

GBIFGlobal Biodiversity Information Facility784 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionNPASS7 compounds

Occurrence & distributionGBIF784 records

Environmental DNA2 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition7 compounds

Compounds documented for Australoporus tasmanicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthraquinones and anthrones7

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
1,8-Dihydroxy-3,7-dimethoxy-2-methyl-anthracene-9,10-dione	present	NPASS
2-(Butoxymethyl)-1,3-dihydroxyanthracene-9,10-dione	present	NPASS
Damnacanthol	present	NPASS
Ibericin	present	NPASS
Lucidin primeveroside	present	NPASS
Morindone	present	NPASS
Rubiadin	present	NPASS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Australoporus tasmanicus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN007009.1 ↗411 bpNew Zealand · 1988

ACGT

TTTATTATAAACTCTTAAAAGTATTAGAACGCATATTTATGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCG …

Australoporus tasmanicus isolate NZFS 226 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type784 records

Wild obs. + sensor648

Museum / vouchered132

Cultivated / captive4

Range

Area of Occupancy AOO740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 232≤1 km 23≤10 km 25>10 km 4

284 georeferenced · 364 without coordinates

Open the mapobservation + sensor648

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 2≤1 km 18≤10 km 64

84 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence132

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	67
Auckland, NZ	28
Olocation not on record	15
DPIlocation not on record	9
Hobart, AU	5
Canberra, AU	5
Brisbane, AU	2
Leicester, GB	1

8 institutions · 132 of 132 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Australoporus tasmanicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH4.70

Conductivity51.0 µS/cm

Organic carbon3.20 %

Phosphorus2.00 mg/kg

Clay33.1 %

Sand29.0 %

Depth0.2 m

SoilKurosol

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 14.2–14.2

Seasonal swing summer↔winter7.70 °C

Max temp (day)18.0 °C

Min temp (night)10.2 °C

Precipitation83.2 mm/mo

Air humidity60.0 %

Moisture balance-44.9 mm/mo

Vapour deficit647 Pa

Wind speed1.90 m/s

Cloud cover35.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)