Australina pusilla

(Poir.) Gaudich. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Australina

At a glance

Occurrence records1 548

Data sources8

Biological traits34

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Australina pusilla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 548 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF1 548 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Australina pusilla là loài thực vật có hoa trong họ Tầm ma. Loài này được (Poir.) Gaudich. mô tả khoa học đầu tiên năm 1830.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology12

Fruit length1.5 mm

Leaf length35 mm

Leaf length max40 mm

Leaf length min5 mm

Leaf size1 571 mm²

Leaf width27.5 mm

Petiole length1.75 cm

Plant height0.4 m

Plant height max0.2 m

Seed length1.5 mm

Seed mass0.252 mg

Seed width0.5 mm

Life cycle & reproduction8

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyyynnnnnnyyy

Life formsubshrub

Life spanperennial

Pollination syndromeabiotic

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical obovate orbicular ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Australina pusilla has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes5

GenBank sequences7

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOM892758.1 ↗5 841 bp

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC …

Australina pusilla isolate Au6 18S small subunit ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Australina pusilla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · new-zealand · CCDB · book-fedorov

CCDB · new-zealand

CCDB · book-fedorov — Hair, Beuzenberg 1960

08Occurrence & distribution

Record type1 548 records

Wild obs. + sensor1 260

Museum / vouchered288

Origin

Native24

Range

Area of Occupancy AOO3 860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 858≤1 km 199≤10 km 84>10 km 16

1 157 georeferenced · 103 without coordinates

Open the mapobservation + sensor1 260

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 14≤1 km 74≤10 km 59>10 km 3

150 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence288

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	66
Auckland, NZ	65
Wellington, NZ	41
Museo Entomologico de Leonlocation not on record	30
Mount Annan, AU	24
Christchurch, NZ	14
Rotorua, NZ	9
Adelaide, AU	8
QVMAGlocation not on record	7
Armidale, AU	5
Canberra, AU	5
Parkville, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Stockholm, SE	1
Brisbane, AU	1
Wollongong, AU	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Chicago, US	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
Batemans Bay, AU	1

21 institutions · 287 of 288 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Australina pusilla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.6–15.6

Seasonal swing summer↔winter11.8 °C

Max temp (day)21.1 °C

Min temp (night)10.7 °C

Precipitation76.0 mm/mo

Air humidity59.2 %

Moisture balance-31.4 mm/mo

Vapour deficit736 Pa

Wind speed2.50 m/s

Cloud cover22.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Australina pusilla

At a glance

Sources8 archives

Size & morphology12

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 548 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 548 records