Auriscalpium villipes — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Russulales/Auriscalpiaceae/Auriscalpium

At a glance

Occurrence records64

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Auriscalpium villipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF64 records

DNA & barcodingNCBIsequences

01Narrative

Auriscalpium villipes is a species of fungus in the family Auriscalpiaceae of the Russulales order. It is a spine fungus that grows on dead wood, and is found in South America (Brazil) and Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Auriscalpium villipes has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSAF454429.1 ↗655 bp

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAAGCTCGAAGGGCCCTAGGTTGTCGCTGGCTTATCCCCTTGCGGGACAAGCATGTG …

Auriscalpium villipes strain 4396 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor20

Museum / vouchered44

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 5≤1 km 1≤10 km 2>10 km 3

11 georeferenced · 9 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 18≤1 km 1≤10 km 4

23 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	9
IPA/SPlocation not on record	7
Olocation not on record	5
Fungario QCAM de la Pontificia Universidad Católica del Ecuadorlocation not on record	5
Ciudad de México, MX	4
TENN-Flocation not on record	3
Durango, MX	3
Zapopan, MX	2
UFPElocation not on record	1
Tlalnepantla, MX	1
UEGlocation not on record	1
Instituto Tecnológico de Ciudad Victorialocation not on record	1
National Biodiversity Institute, Costa Ricalocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1

14 institutions · 44 of 44 vouchered records shown