Auriscalpium umbella — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Russulales/Auriscalpiaceae/Auriscalpium

At a glance

Occurrence records68

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Auriscalpium umbella's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility68 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF68 records

DNA & barcodingNCBIsequences

01Narrative

Auriscalpium umbella is a species of fungus in the family Auriscalpiaceae of the Russulales order. Described by the Dutch mycologist Rudolph Arnold Maas Geesteranus in 1971, it is known from New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Auriscalpium umbella has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP262626.1 ↗446 bpNew Zealand · 2007

ACGT

TCGAAGCTTGAAGGCCTAGGTTGTCGCTGGCCCTCCGGGGCATGTGCACGCCTACGGTCGACAACCACGTTCCTTCACACACCCCCCTGT …

Auriscalpium umbella isolate JAC 10335 voucher PDD:87423 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor45

Museum / vouchered23

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 23≤1 km 8≤10 km 3>10 km 1

35 georeferenced · 10 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1≤10 km 1

4 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	18
Leicester, GB	2

2 institutions · 20 of 23 vouchered records shown · 3 without an institution code