Auriporia aurulenta

A.David, Tortič & Jelić · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Fomitopsidaceae/Auriporia

At a glance

Occurrence records248

Data sources8

Biological traits0

DNA specimens2

eDNA detections3

Sources8 archives

Databases and archives Auriporia aurulenta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility248 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF248 records

Environmental DNA2 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Auriporia aurulenta is a species of poroid crust fungus. It was described as a new species in 1975. A central European species, it has been recorded from Austria, Czechoslovakia, France, Yugoslavia, South Germany, Switzerland, and the Ukraine. The fungus is recognized in the field by its deep orange-yellow colour that becomes ochre in age. Microscopically, it features thick-walled cystidia that typically measure 20–35 by 8–12 µm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Auriporia aurulenta has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences6

eDNA detections3

Countries4

The DNA barcodea real sequence read deposited for this species

ITSJX157581.1 ↗489 bpBrazil

ACGT

AAAGGGGACTTGACTGTTTCCTTTCGGGCCTTCCTACGTTTCAACTTTATAAACCACCATAGTCTATAGAATGTCATCTGCGTATAACGC …

Auriporia aurulenta voucher DBB5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type248 records

Wild obs. + sensor180

Museum / vouchered68

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 11≤1 km 11≤10 km 133>10 km 2

157 georeferenced · 23 without coordinates

Open the mapobservation + sensor180

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 2≤1 km 17≤10 km 17>10 km 1

37 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of the Basque Country (UPV/EHU)location not on record	8
San Sebastián, ES	6
Olocation not on record	6
WU-MYClocation not on record	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
Helsinki, FI	5
Karlsruhe, DE	4
UNINE:NEUlocation not on record	3
Mlocation not on record	2
Zürich, CH	2
GJOlocation not on record	2
Vitoria, ES	2
Tartu, EE	1
Bardejov, SK	1
Salzburg, AT	1
Görlitz, DE	1
Durham, US	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
UFSClocation not on record	1

19 institutions · 58 of 68 vouchered records shown · 9 without an institution code

09Environmental DNA3 detections

Where the DNA of Auriporia aurulenta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 9.20–16.7

Seasonal swing summer↔winter18.4 °C

Max temp (day)16.9 °C 12.9–20.9

Min temp (night)8.70 °C 5.20–12.1

Precipitation68.9 mm/mo 59.9–77.9

Air humidity60.7 % 59.4–62.0

Moisture balance-31.2 mm/mo -48.6–-13.9

Vapour deficit652 Pa 507–797

Wind speed3.40 m/s 3.40–3.50

Cloud cover38.2 % 35.3–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)