Auricularia heimuer

F.Wu, B.K.Cui & Y.C.Dai · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Auriculariales/Auriculariaceae/Auricularia

At a glance

Occurrence records7

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Auricularia heimuer's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈50 Mbp

01Narrative

Auricularia heimuer (黑木耳 heimuer or black wood ear) is a species of fungus in the order Auriculariales. It is commercially cultivated for food in China at a level exceeding $4 billion (USD) per year. The species was previously referred to the European Auricularia auricula-judae, but the latter is not known to occur in east Asia. Auricularia heimuer is a popular ingredient in many Chinese dishes, such as hot and sour soup, and is also used in traditional Chinese medicine.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Auricularia heimuer has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP382448.1 ↗548 bp

ACGT

GATTCTAAGGCTTCGGTCTTAATTTCGGCTGTGCGCTCAGGCTGCACGCCGATAACCTCTCACACCTGTGCACCTTTTCGGTTGCGGTTT …

Auricularia heimuer isolate SLF14 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Auricularia heimuer carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈49 761 846 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Auricularia heimuer0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness83.8% BUSCO

08Occurrence & distribution

Record type7 records

Wild obs. + sensor6

Museum / vouchered1

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1≤10 km 2

4 georeferenced · 2 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)