Auricularia cornea

Ehrenb. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Auriculariales/Auriculariaceae/Auricularia

At a glance

Occurrence records6 086

Data sources9

Biological traits0

DNA specimens29

eDNA detections36

Sources9 archives

Databases and archives Auricularia cornea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 086 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 086 records

Environmental DNA4 datasets · 8 countries36 detections

DNA & barcodingBOLD · NCBI29 specimens

Genome at a glanceGoaT · NCBI≈79 Mbp

01Narrative

Auricularia cornea est un vrai champignon (Eumycète) de la famille des Auriculariaceae. On parle communément du champignon oreilles, par rapport avec sa forme et sa texture gélatineuse.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Auricularia cornea has left across the world's sequence archives.

At a glance

DNA specimens29

Marker genes2

GenBank sequences10

eDNA detections36

Countries9

The DNA barcodea real sequence read deposited for this species

ITSPX927798.1 ↗226 bpSouth Korea · 2025

ACGT

ACTGCGGAGGATCATTAAAGATTTTGGGCTTTTAACCCGATCGTTCAGCTGTGCGCCCTTCACCGGGCTGCACGCTGGAGCAAGACCCCA …

Auricularia cornea voucher KA25-0697 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Auricularia cornea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈78 720 327 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Auricularia cornea0.08 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness83.5% BUSCO

08Occurrence & distribution

Record type6 086 records

Wild obs. + sensor5 404

Museum / vouchered672

Cultivated / captive3

Other7

Range

Area of Occupancy AOO11 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 2 650≤1 km 1 097≤10 km 414>10 km 249

4 410 georeferenced · 994 without coordinates

Open the mapobservation + sensor5 404

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 30≤1 km 30≤10 km 154>10 km 24

238 georeferenced · 434 without coordinates

Open the institutions mapphysical evidence672

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	144
Museo Entomologico de Leonlocation not on record	118
UFPElocation not on record	65
Brisbane, AU	56
DPIlocation not on record	45
MeiseBGlocation not on record	42
Durango, MX	40
IPA/SPlocation not on record	30
Kensington, AU	24
Canberra, AU	19
BISHlocation not on record	19
Leicester, GB	6
UFMSlocation not on record	5
University of the Philippines Los Baños Museum of Natural Historylocation not on record	4
Philadelphia, US	4
ILLSlocation not on record	4
Honolulu, US	4
Baton Rouge, US	4
Bernard Price Institute for Palaeontological Researchlocation not on record	3
National Institute of Biological Resourceslocation not on record	3
Tartu, EE	3
TENN-Flocation not on record	3
Champaign, US	2
Catholic University of Pekinglocation not on record	2
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1
UESBlocation not on record	1
Helsinki, FI	1
Smithfield, AU	1
Göteborg, SE	1
Kew, GB	1
UFPRlocation not on record	1
JBRJlocation not on record	1
HAW-Flocation not on record	1
Logan, US	1
Universidad de Antioquialocation not on record	1

35 institutions · 660 of 672 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA36 detections

Where the DNA of Auricularia cornea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys4

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map8 countries0

PalearcticNeotropicAfrotropicBosque Seco Tropical

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 17.2–27.2

Seasonal swing summer↔winter3.20 °C

Max temp (day)27.8 °C 21.4–32.1

Min temp (night)23.2 °C 12.1–25.3

Precipitation98.9 mm/mo 49.0–207

Air humidity61.2 % 52.3–68.2

Moisture balance-30.9 mm/mo

Vapour deficit1,264 Pa 806–1,816

Wind speed2.20 m/s

Cloud cover27.5 % 18.1–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Auricularia cornea

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 086 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 086 records