Auricularia angiospermarum

Y.C.Dai, F.Wu & D.W.Li · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Auriculariales/Auriculariaceae/Auricularia

At a glance

Occurrence records733

Data sources7

Biological traits0

DNA specimens4

eDNA detections8

Sources7 archives

Databases and archives Auricularia angiospermarum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility733 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF733 records

Environmental DNA6 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Auricularia angiospermarum (wood ear or tree ear) is a species of fungus in the family Auriculariaceae. Basidiocarps (fruitbodies) are gelatinous, ear-like, and grow on dead wood of broadleaf trees. It is a North American species and was formerly confused with Auricularia auricula-judae which is confined to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Auricularia angiospermarum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX627346.1 ↗578 bpUSA · 2022

ACGT

AAGATTCCGAGGCTCCGGCCTTGACTTTTTCATTCAGCTGTGCGCTTCGGCTGCACGCTGGACGATAATCTCACACCTGTGCACCTTTTC …

Auricularia angiospermarum voucher DBG:F-033363,iNat#134458943 v1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type733 records

Wild obs. + sensor721

Museum / vouchered12

Range

Area of Occupancy AOO2 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 248≤1 km 88≤10 km 56>10 km 70

462 georeferenced · 259 without coordinates

Open the mapobservation + sensor721

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	3
Chicago, US	2
Bronx, US	1
Denver, US	1
ILLSlocation not on record	1

5 institutions · 8 of 12 vouchered records shown · 4 without an institution code

09Environmental DNA8 detections

Where the DNA of Auricularia angiospermarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys6

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.78

Conductivity25.7 µS/cm

Organic carbon0.37 %

Water content15.5 %

Phosphorus1,130 mg/kg

Sand56.7 %

Depth0 m

SoilLatLon out of range

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-7.00 °C -7.00–1.20

Seasonal swing summer↔winter13.1 °C

Max temp (day)-5.30 °C -5.30–4.00

Min temp (night)-9.20 °C -9.20–-1.80

Precipitation56.4 mm/mo 56.4–59.5

Air humidity58.8 % 58.8–64.2

Vapour deficit150 Pa 150–303

Cloud cover56.9 % 56.7–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)