Auricularia americana

Parmasto & I.Parmasto ex Audet, Boulet & Sirard · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Auriculariales/Auriculariaceae/Auricularia

At a glance

Occurrence records1 251

Data sources8

Biological traits0

DNA specimens15

eDNA detections15

Sources8 archives

Databases and archives Auricularia americana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 251 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD · NCBI15 specimens

01Narrative

Auricularia americana is a species of fungus in the family Auriculariaceae. Basidiocarps (fruitbodies} are gelatinous, ear-like, and grow on dead conifer wood. The species was formerly confused with Auricularia auricula-judae, which grows on broadleaf wood and is confined to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Auricularia americana has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes2

GenBank sequences10

eDNA detections15

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOQ628496.1 ↗536 bpUSA · 2018

ACGT

GTGAACCTGCGGAAGGATCATTAAAGATTCTGAGGCTCGTCCTCGACTTTCATTCAGCTGTGCGCTTGTGCTGCACGCTGGACGATAATC …

Auricularia americana isolate SAT-18-234-19 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 251 records

Wild obs. + sensor1 226

Museum / vouchered25

Range

Area of Occupancy AOO4 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 652≤1 km 156≤10 km 69>10 km 98

975 georeferenced · 251 without coordinates

Open the mapobservation + sensor1 226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 4≤1 km 3≤10 km 1>10 km 1

9 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université de Montréal Biodiversity Centrelocation not on record	8
Helsinki, FI	5
Universidade de Lisboa, Museu Bocagelocation not on record	2
Personal Herbarium of Gabriela D'elialocation not on record	1
Private Collection of Jessica Rosslocation not on record	1
Rene Pomerleau Herbariumlocation not on record	1
Toronto, CA	1

7 institutions · 19 of 25 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Auricularia americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

epinette resineux

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 0.1–20.4

Seasonal swing summer↔winter27.0 °C

Max temp (day)23.7 °C 6.30–26.8

Min temp (night)12.5 °C -4.00–15.5

Precipitation88.7 mm/mo 20.8–128

Air humidity57.4 % 53.5–60.1

Moisture balance-30.6 mm/mo -97.9–-8.30

Vapour deficit873 Pa 262–1,115

Wind speed5.60 m/s 2.30–5.90

Cloud cover39.5 % 25.0–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Auricularia americana

At a glance

Sources8 archives

At a glance

Record type1 251 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 251 records