Aureolaria pedicularia

(L.) Raf. ex Pennell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Aureolaria

At a glance

Occurrence records1 408

Data sources12

Biological traits14

DNA specimens7

eDNA detections5

Sources12 archives

Databases and archives Aureolaria pedicularia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 408 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF1 408 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · NCBI≈1.2 Gbp

01Narrative

Aureolaria pedicularia, the fernleaf yellow false foxglove, fern-leaved false foxglove, or fernleaf false foxglove, is a parasitic plant of the family Orobanchaceae. Aureolaria pedicularia is native to parts of the eastern US, the Midwest, and adjacent Canada. This plant is known for its distinct leaf shape and overall plant size. The common names for Aureolaria pedicularia come from its fern-like leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height1 m

Seed mass0.079 mg

Seed mass max0.079 mg

Seed mass min0.079 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aureolaria pedicularia has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG218407.1 ↗355 bpCanada

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Aureolaria pedicularia voucher 42778HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Aureolaria pedicularia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 195 014 647 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aureolaria pedicularia1.2 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Kondo, K., M. Segawa, L. J. Musselman & W. F. MANN. 1981. Comparative ecological study of the chromosome races in certain root parasitic plants of the southeastern U.S.A. Bol. Soc. Brot., sér. 2 53: 793–807.

CCDB · book-ipcn75-78 — Kondo et al. 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 408 records

Wild obs. + sensor922

Museum / vouchered485

Other1

Origin

Native1

Range

Area of Occupancy AOO3 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 473≤1 km 89≤10 km 23>10 km 193

778 georeferenced · 144 without coordinates

Open the mapobservation + sensor922

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 5≤1 km 91≤10 km 257>10 km 54

407 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence485

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	159
Chongqing Museumlocation not on record	42
Madison, US	34
University of New Hampshirelocation not on record	32
Bangkok, TH	32
Ann Arbor, US	31
New Haven, US	19
Chapel Hill, US	11
Staten Island, US	10
Williamsburg, US	10
Miami, US	10
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	9
College Park, US	8
Allentown, US	8
Columbia, US	7
Philadelphia, US	5
Bloomington, US	5
Norfolk, US	4
Burlington, US	4
Johnson City, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Maryland Department of Natural Resourceslocation not on record	3
Chicago, US	3
Dekalb, US	2
McWane Science Centerlocation not on record	2
University of Guelph, OAC Herbariumlocation not on record	2
Millersville, US	1
Chicago, US	1
Museum of the Rockieslocation not on record	1
Oskarshamn, SE	1
Durham, US	1
New Brunswick, US	1
Fredericksburg, US	1
Asheville, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
Durham, US	1
Denver, US	1
Fredericton Stock Culture Collectionlocation not on record	1
Weymouth Woods Sandhills Nature Preservelocation not on record	1
Lord Fairfax Community Collegelocation not on record	1
Jackson, US	1
Northridge, US	1
Mexico City, MX	1
Moscow State Universitylocation not on record	1
Baltimore, US	1
DOI/NPS, Greenbelt Parklocation not on record	1

46 institutions · 479 of 485 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Aureolaria pedicularia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 9.80–16.9

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 14.5–20.1

Min temp (night)8.20 °C 6.00–14.5

Precipitation80.8 mm/mo 79.6–104

Air humidity58.2 % 57.3–59.8

Moisture balance-29.8 mm/mo -38.4–-10.7

Vapour deficit733 Pa 608–821

Wind speed5.80 m/s 4.70–6.20

Cloud cover41.1 % 36.7–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aureolaria pedicularia

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 408 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions32 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 408 records