Aureoboletus gentilis

(Quél.) Pouzar · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Aureoboletus

At a glance

Occurrence records1 901

Data sources10

Biological traits0

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Aureoboletus gentilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 901 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 901 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT · NCBI≈41 Mbp

01Narrative

Aureoboletus gentilis is a species of bolete fungus in the family Boletaceae. Originally described as Boletus sanguineus var. gentilis by French mycologist Lucien Quélet in 1884, it was transferred to the genus Aureoboletus by Zdeněk Pouzar in 1957. It is considered vulnerable in the Czech Republic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aureoboletus gentilis has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences5

eDNA detections5

Countries5

The DNA barcodea real sequence read deposited for this species

ITSHM003620.1 ↗591 bpItaly

ACGT

AGATGGGAATAGTCTACGACTGTCGCTGGCTCTTTTGCATGTGCACGTCTTTGCTATCTCTGTCAACCTTTCTGAAAATACACACACCTG …

Aureoboletus gentilis from Italy internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aureoboletus gentilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈40 958 937 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aureoboletus gentilis0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness91.1% BUSCO

08Occurrence & distribution

Record type1 901 records

Wild obs. + sensor1 619

Museum / vouchered270

Other12

Origin

Native1

Range

Area of Occupancy AOO3 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 407≤1 km 272≤10 km 681>10 km 94

1 454 georeferenced · 165 without coordinates

Open the mapobservation + sensor1 619

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 29≤1 km 93≤10 km 43>10 km 1

166 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence270

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	33
SLU Artdatabankenlocation not on record	25
Kew, GB	16
Olocation not on record	14
Bardejov, SK	13
Göteborg, SE	12
BDBClocation not on record	9
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	9
Karlsruhe, DE	8
Davis and Elkins Collegelocation not on record	7
GJOlocation not on record	7
San Sebastián, ES	7
Copenhagen, DK	5
JA-CAGPDS-CAMlocation not on record	4
MAlocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Zürich, CH	3
Uppsala, SE	3
University of the Basque Country (UPV/EHU)location not on record	3
Guatemala City, GT	3
MeiseBGlocation not on record	2
TUR-Alocation not on record	2
Universidade de Lisboa, Museu Bocagelocation not on record	2
Córdoba, ES	2
Stockholm, SE	2
University of Oslo, Natural History Museumlocation not on record	2
Trondheim, NO	2
HabitatVisionlocation not on record	1
Vitoria, ES	1
Royal Botanic Gardens, Kewlocation not on record	1
Mérida, ES	1
Tartu, EE	1
Gijón, ES	1
PRClocation not on record	1
Tilburg, NL	1
nsnflocation not on record	1
Salzburg, AT	1
LDlocation not on record	1
Helsinki, FI	1

39 institutions · 215 of 270 vouchered records shown · 54 without an institution code

09Environmental DNA5 detections

Where the DNA of Aureoboletus gentilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

Edellovskog med mest eik og furuNA T4-C-2 Svak lagurtskog. Eik.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 8.80–16.1

Seasonal swing summer↔winter16.6 °C

Max temp (day)16.9 °C 10.4–18.9

Min temp (night)10.3 °C 6.30–13.5

Precipitation106 mm/mo 80.9–114

Air humidity60.6 % 58.9–64.5

Moisture balance54.1 mm/mo

Vapour deficit677 Pa 417–776

Wind speed4.90 m/s

Cloud cover43.9 % 41.6–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aureoboletus gentilis

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 901 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 901 records