Aureoboletus auriporus

(Peck) Pouzar · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Aureoboletus

At a glance

Occurrence records381

Data sources9

Biological traits0

DNA specimens0

eDNA detections4

Sources9 archives

Databases and archives Aureoboletus auriporus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility381 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF381 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈60 Mbp

01Narrative

Aureoboletus auriporus, is a species of bolete fungus in the family Boletaceae that is found in Europe and North America. It was originally described in 1872 by American mycologist Charles Horton Peck, who called it Boletus auriporus. Zdenek Pouzar transferred it to the genus Aureoboletus in 1957. The species is edible, and could be confused with (the also edible) Xerocomus illudens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aureoboletus auriporus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV920808.1 ↗336 bpUSA · 2023

ACGT

GAACGCACCTTGCGCTCCTTGGTATTCCAAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATGTCTTGATTGACCTGGCTTGG …

Aureoboletus auriporus isolate S. D. Russell iNat # 174395758 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aureoboletus auriporus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈60 408 856 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aureoboletus auriporus0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type381 records

Wild obs. + sensor339

Museum / vouchered34

Other8

Origin

Native2

Range

Area of Occupancy AOO1 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 109≤1 km 41≤10 km 47>10 km 46

243 georeferenced · 96 without coordinates

Open the mapobservation + sensor339

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 5≤10 km 7

14 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	8
Bronx, US	7
Chicago, US	5
Colorado State Universitylocation not on record	4
Tomioka, JP	3
Durham, US	2
PHlocation not on record	2
TENN-Flocation not on record	1

8 institutions · 32 of 34 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Aureoboletus auriporus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 16.5–16.5

Seasonal swing summer↔winter7.60 °C

Max temp (day)21.6 °C

Min temp (night)11.8 °C

Precipitation37.9 mm/mo

Air humidity69.2 %

Moisture balance-36.9 mm/mo

Vapour deficit574 Pa

Wind speed1.10 m/s

Cloud cover38.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)