Aulacocalyx caudata

(Hiern) Keay · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Aulacocalyx

At a glance

Occurrence records317

Data sources8

Biological traits9

DNA specimens6

eDNA detections3

Sources8 archives

Databases and archives Aulacocalyx caudata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF317 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Aulacocalyx caudata là một loài thực vật có hoa trong họ Thiến thảo. Loài này được (Hiern) Keay mô tả khoa học đầu tiên năm 1958.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aulacocalyx caudata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK123587.1 ↗517 bp

ACGT

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTATCCTGCGAACGACCGCGAACTCGTGTAACCACCGGGCGTCGGGGGTTGGCCG …

Aulacocalyx caudata voucher Mambo & Thomas 79 (P) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type317 records

Wild obs. + sensor15

Museum / vouchered302

Range

Area of Occupancy AOO456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 15>10 km 1

16 georeferenced · 286 without coordinates

Open the institutions mapphysical evidence302

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	39
Saint Louis, US	37
Kew, GB	34
Yaoundé, CM	31
Brussels, BE	24
BRLUlocation not on record	15
LBVlocation not on record	11
Plocation not on record	8
Herbier National du Gabonlocation not on record	8
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	6
WAGlocation not on record	6
Chongqing Museumlocation not on record	2
Universite Libre de Bruxelles, Herbariumlocation not on record	2
Paris, FR	1
Bronx, US	1
Stockholm, SE	1
Claremont, US	1
University of Stellenboschlocation not on record	1
Universite Libre de Bruxelleslocation not on record	1
Uppsala, SE	1

20 institutions · 230 of 302 vouchered records shown · 72 without an institution code

09Environmental DNA3 detections

Where the DNA of Aulacocalyx caudata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter2.80 °C

Max temp (day)27.7 °C

Min temp (night)21.8 °C

Precipitation405 mm/mo

Air humidity74.7 %

Moisture balance296 mm/mo

Vapour deficit763 Pa

Wind speed0.9 m/s

Cloud cover33.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)