Aucuba chinensis

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Garryales/Garryaceae/Aucuba

At a glance

Occurrence records854

Data sources12

Biological traits32

DNA specimens4

eDNA detections2

Sources12 archives

Databases and archives Aucuba chinensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility854 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Chemical compositionNPASS47 compounds

Occurrence & distributionGBIF854 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Aucuba chinensis is a shrub or small tree, native to southern China, Taiwan, Burma and northern Vietnam. Typically it grows to 6 meters tall, though it can be larger. The leaves are thick, dark green above and light green below, sometimes with teeth along the margins.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length16 mm

Fruit length max18 mm

Fruit length min14 mm

Fruit width9 mm

Fruit width max10 mm

Fruit width min8 mm

Leaf length150 mm

Leaf length max200 mm

Leaf length min100 mm

Leaf width max80 mm

Leaf width min35 mm

Plant height4.5 m

⚠ sources differ — GIFT: 4.5 m · TRY: 9 m

Plant height max6 m

Plant height min3 m

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 600 m

Elevation mean1 000 m

Elevation min1 000 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Leaf n14.4 mg/g

Leaf p0.82 mg/g

Photosynthetic pathwayC3

03Chemical composition47 compounds

Compounds documented for Aucuba chinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones7

Cinnamic acids and derivatives6

Simple phenolic acids6

Flavonols5

Flavanones3

Documented compounds47 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(2R,3R,4S,5S,6R)-2-[(1R,2S)-3-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-2-[4-[(E)-3-hydroxyprop-1-enyl]-2,6-dimethoxyphenoxy]propoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S)-5,7,3',4'-Tetrahydroxyflavanone 6-C-glucoside	present	NPASS
(Z)-3-phenyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-2-enoic acid	present	NPASS
3,5-Dihydroxybenzoic acid	present	NPASS
4-Hydroxybenzoic acid	present	NPASS
Aesculetin	present	NPASS
AKGDIVKDYFDRLS-VJCFOKSDSA-N	present	NPASS
Aspalathin	present	NPASS
Catechin	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aucuba chinensis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY123839.1 ↗228 bp

ACGT

CGCATCGCGTCGCCCCCCTCCTCGACCTTGTGCCGATCCGTGGGGAGCGGAAAATGGCCTCCCGTGCTCCTCCCCGGTGCGTGGTTGGCC …

Aucuba chinensis isolate LHS33 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL6★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aucuba chinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 167×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +3

CCDB · ipcn-api-dl — Kurosawa, S. 1981. Notes on chromosome numbers of Spermatophytes III. J. Jap. Bot. 56: 245–251.

CCDB · book-ipcn67-71 — Q6 KUROSAWA, s. 1971. Cytotaxonomical studies on the genus Aucuba. J. Jap. Bot. Q6: 231-238.

CCDB · book-ipcn73-74 — KUROSAWA, s. 1971. Cytological studies on some eastern Himalayan plants and their related species. The Flora of eastern Himalaya. Second report. pp. 355-364. Univ. Tokyo Press.

CCDB · eflora

CCDB · book-fedorov — Meurman 1930

CCDB · book-fedorov — Kihara, Yamamoto 1935

CCDB · book-atlas-flowering-plants — Kihara & Y. 1935

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type854 records

Wild obs. + sensor273

Museum / vouchered579

Cultivated / captive2

Origin

Native16

Range

Area of Occupancy AOO1 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 73≤1 km 18≤10 km 12>10 km 11

114 georeferenced · 159 without coordinates

Open the mapobservation + sensor273

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 577 without coordinates

Open the institutions mapphysical evidence579

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	87
Taipei, TW	84
Beijing, CN	68
National Museum of Natural Sciencelocation not on record	54
Chengdu, CN	42
Guilin, CN	29
Taipei, TW	23
Kunming, CN	19
Yangling, CN	17
TAIElocation not on record	16
Guiyang, CN	13
Wuhan, CN	13
Nanjing, CN	12
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	10
Zhejiang Universitylocation not on record	8
Nanjing, CN	8
Zhuzhou, CN	7
Fujian Institute of Subtropical Botanylocation not on record	6
Shanghai, CN	6
Guangzhou, CN	5
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	4
湖北神农架林区标本馆location not on record	4
SCAUlocation not on record	4
Central China Normal Universitylocation not on record	3
Jishou Universitylocation not on record	3
Xian, CN	3
Changsha, CN	3
Seoul, KR	2
Saint Louis, US	2
Herbarium of South China Botanical Gardenlocation not on record	2
Moscow State Universitylocation not on record	2
Central China Agricultural Universitylocation not on record	2
Xiamen, CN	2
Stockholm, SE	2
Guizhou Forestry Schoollocation not on record	2
Wuhan, CN	2
MeiseBGlocation not on record	1
WNNUlocation not on record	1
Nagasaki University - Fisherieslocation not on record	1
Guiyang, CN	1
South China Normal Universitylocation not on record	1
Chengdu, CN	1
Kew, GB	1
Cincinnati, US	1
New Haven, US	1
Edinburgh, GB	1

46 institutions · 579 of 579 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Aucuba chinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 17.4–17.4

Seasonal swing summer↔winter9.20 °C

Max temp (day)21.6 °C

Min temp (night)12.2 °C

Precipitation178 mm/mo

Air humidity65.7 %

Moisture balance78.2 mm/mo

Vapour deficit677 Pa

Wind speed1.80 m/s

Cloud cover43.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)