Attalea speciosa

Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Attalea

At a glance

Occurrence records190

Data sources12

Biological traits33

DNA specimens0

eDNA detections1

Sources12 archives

Databases and archives Attalea speciosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility190 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Chemical compositionFooDB · LOTUS · NPASS5 578 compounds

Occurrence & distributionGBIF190 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 32

01Narrative

Attalea speciosa est une espèce de plantes à fleurs de famille des Arecaceae. Elle est originaire d'Amérique du Sud. Ses fruits, semblables à de petites noix de coco, forment de grosses grappes,et fournissent une huile utilisée pour la production de biocarburants ou en cosmétique. L'espèce est appelée « babaçu » en portugais, et est parfois francisé en « babassou » ou « babassu ».

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length95.5 mm

Fruit length max125 mm

Fruit length min66 mm

Fruit width68 mm

Fruit width max99 mm

Fruit width min37 mm

Leaf length max7 820 mm

Plant height30 m

⚠ sources differ — GIFT: 30 m · TRY: 13.5 m

Plant height max15 m

Seed mass290 mg

Seed mass max290 mg

Seed mass min290 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourbrown

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Palm

Habitat GIFTÁrea Antrópica, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial), Palmeiral

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits5

Dbh max41 cm

Defenseno

Leaf spinesno

Shoot length max2 000 cm

Shoot orientationerect

03Chemical composition5 578 compounds

Compounds documented for Attalea speciosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingHerbs and Spices

Compound class profile5 classes

Aminoacids68

Glycerophospholipids57

Cinnamic acids and derivatives30

Purine nucleos(t)ides26

Monosaccharides25

Documented compounds5 578 total

Tissue Source Quantified only

Compound	Amount	Source
Dodecanoic acid	43,500 mg/100g	FooDB
Octanoic acid	6,000 mg/100g	FooDB
Decanoic acid	5,500 mg/100g	FooDB
butyl acetate	200 mg/100g	FooDB
alpha-Tocopherol	19.1 mg/100g	FooDB
Doconexent	0 mg/100g	FooDB
Potassium	0 mg/100g	FooDB
Nicotinic acid	0 mg/100g	FooDB
Eicosapentaenoic acid	0 mg/100g	FooDB
Sugars	0 mg/100g	FooDB

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Attalea speciosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLAY012508.1 ↗1 501 bp

ACGT

ATGTCACCACAAACAGAGAATAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAA …

Orbignya barbosiana ribulose bisphosphate carboxylase large subunit (rbcL) gene, complete cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Attalea speciosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Carvalho, M. D. F. d. & G. Bandel. 1986. Citogenética do babaçu (Orbignya spp.). Ci. & Cult. (Sao Paulo) 38: 930.

CCDB · book-fedorov — Gassner 1941

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type190 records

Wild obs. + sensor101

Museum / vouchered88

Cultivated / captive1

Range

Area of Occupancy AOO484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 43≤1 km 20≤10 km 7>10 km 8

78 georeferenced · 23 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 2>10 km 3

6 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence88

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	55
Université de Bordeauxlocation not on record	6
Miami, US	4
Kew, GB	3
University of Stellenboschlocation not on record	3
Stockholm, SE	2
Universidad Nacional de Colombia (UNAL)location not on record	2
H. Balslevlocation not on record	1

8 institutions · 76 of 88 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Attalea speciosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Attalea speciosa

At a glance

Sources12 archives

Size & morphology12

Life cycle & reproduction5

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Other traits5

Compound class profile5 classes

Documented compounds5 578 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type190 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Documented compounds5 578 total