Attalea amygdalina

Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Attalea

At a glance

Occurrence records188

Data sources6

Biological traits27

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Attalea amygdalina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility188 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF188 records

DNA & barcodingNCBIsequences

01Narrative

Attalea amygdalina is a species of palm endemic to Colombia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length75 mm

Fruit length max90 mm

Fruit length min60 mm

Fruit width50 mm

Leaf length max9 320 mm

Plant height7 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 600 m

Elevation min1 000 m

Epiphyteterrestrial

Fruit colourbrown

Growth formshrub

Habitat GIFTunderstorey

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits5

Dbh max25 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max50 cm

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Attalea amygdalina has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK691829.1 ↗496 bp

ACGT

AATTGCAGAATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGTCGAGGGCACGCCTGCCTGGGCGTCACGC …

Attalea amygdalina voucher SCBG948 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type188 records

Wild obs. + sensor10

Museum / vouchered177

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced · 6 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤1 km 10≤10 km 14

24 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence177

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	145
Universidad Nacional de Colombia (UNAL)location not on record	21
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	11

3 institutions · 177 of 177 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)