Attacus atlas

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Attacus

At a glance

Occurrence records1 774

Data sources8

Biological traits0

DNA specimens131

eDNA detections115

Sources8 archives

Databases and archives Attacus atlas's data was compiled from.

WikipediaWikimedia Foundation19 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 774 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI115 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics131 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF1 774 records

Environmental DNA1 datasets · 12 countries115 detections

DNA & barcodingBOLD131 specimens

01Narrative

Attacus atlas, the Atlas moth, is a large saturniid moth endemic to the forests of Asia. The species was first described by Carl Linnaeus in his 1758 10th edition of Systema Naturae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding131 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Attacus atlas has left across the world's sequence archives.

At a glance

DNA specimens131

BINs14

Marker genes12

eDNA detections115

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus107 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

22Tmostly conserved

31Amostly conserved

34Amostly conserved

37Amostly conserved

40Amostly conserved

49Cmostly conserved

59Tmostly conserved

79Cvariable

103Cmostly conserved

136Cvariable

160Amostly conserved

169Tmostly conserved

178Tmostly conserved

196Amostly conserved

217Avariable

220Tvariable

226Tmostly conserved

232Cmostly conserved

250Tvariable

265Tmostly conserved

268Cmostly conserved

274Tmostly conserved

277Tmostly conserved

287Cmostly conserved

289Amostly conserved

292Tmostly conserved

316Amostly conserved

322Avariable

349Tmostly conserved

352Tmostly conserved

358Tmostly conserved

364Tvariable

367Cmostly conserved

370Amostly conserved

376Amostly conserved

391Cvariable

406Tmostly conserved

412Tmostly conserved

415Amostly conserved

433Avariable

481Amostly conserved

484Amostly conserved

500Cmostly conserved

508Tmostly conserved

514Amostly conserved

517Amostly conserved

523Tmostly conserved

542Tmostly conserved

550Amostly conserved

562Gvariable

571Tmostly conserved

574Amostly conserved

589Tmostly conserved

595Tmostly conserved

604Cmostly conserved

616Tvariable

619Tmostly conserved

622Avariable

625Gmostly conserved

628Amostly conserved

631Amostly conserved

634Cmostly conserved

640Cmostly conserved

646Cmostly conserved

653Cmostly conserved

655Tmostly conserved

AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCCTTAAGATTATTAATTCGAGCAGAATTAGGCACCCCCAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 48 variants.

Diversity (π)3.2%

Haplotypes48

BINs14

Most divergent pair7.0%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Attacus taprobanissame genus4.0%Attacus erebussame genus5.8%Attacus caesarsame genus5.9%Attacus paraliaesame genus6.2%Attacus intermediussame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_021770 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 774 records

Wild obs. + sensor1 684

Museum / vouchered90

Range

Area of Occupancy AOO4 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 625≤1 km 356≤10 km 187>10 km 215

1 383 georeferenced · 301 without coordinates

Open the mapobservation + sensor1 684

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 5≤1 km 3≤10 km 30>10 km 25

63 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	19
New Haven, US	11
Natural History Museum Rotterdamlocation not on record	11
Cambridge, US	10
Natural History Museum of Utahlocation not on record	7
Brussels, BE	4
Banyoles, ES	3
Research Collection of Eric Van Schaycklocation not on record	3
QVMAGlocation not on record	3
Tartu, EE	2
Helsinki, FI	2
RBINS-Scientific Heritagelocation not on record	2
Saint John, CA	2
Tasmanian Museum & Art Gallerylocation not on record	2
Vietnam National Museum of Naturelocation not on record	1
Ciudad de México, MX	1
Museums Victorialocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
MZLUlocation not on record	1
Gifu prefectural Museumlocation not on record	1

20 institutions · 87 of 90 vouchered records shown · 3 without an institution code

09Environmental DNA115 detections

Where the DNA of Attacus atlas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found115

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 115 detections have coordinates

Open the map12 countries0

Mixed Deciduous Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 17.2–27.7

Seasonal swing summer↔winter6.60 °C

Max temp (day)27.4 °C 20.4–31.1

Min temp (night)20.5 °C 12.6–25.9

Precipitation263 mm/mo 63.5–438

Air humidity65.8 % 60.8–69.8

Moisture balance139 mm/mo -66.3–466

Vapour deficit1,004 Pa 635–1,319

Wind speed2.00 m/s 1.00–5.10

Cloud cover51.6 % 25.9–73.7

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Attacus atlas

At a glance

Sources8 archives

At a glance

Record type1 774 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 774 records