Atrytonopsis quinteri

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Atrytonopsis

At a glance

Occurrence records121

Data sources4

Biological traits0

DNA specimens3

eDNA detections0

Sources4 archives

Databases and archives Atrytonopsis quinteri's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility121 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF121 records

DNA & barcodingBOLD3 specimens

01Narrative

Atrytonopsis quinteri, the crystal skipper is a newly described butterfly (family Hesperiidae) that is found only along a 30-mile (50 km) stretch of barrier islands in North Carolina. The skipper was first discovered in 1978 and the paper describing it as a full species was published in 2015.Burns 2015

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrytonopsis quinteri has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P393 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes0

BIN1

Where individuals differ — all 1 variable positions, in barcode order

1Nhighly variable

NGAATAAATAATATAAGATTTTGAATATTACCCCCCTCTTTAACATTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCAGGAACTGGT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type121 records

Wild obs. + sensor120

Museum / vouchered1

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 35≤1 km 7≤10 km 3>10 km 65

110 georeferenced · 10 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	1

1 institutions · 1 of 1 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)