Atrytonopsis hianna

(Scudder, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Atrytonopsis

At a glance

Occurrence records2 070

Data sources9

Biological traits0

DNA specimens32

eDNA detections34

Sources9 archives

Databases and archives Atrytonopsis hianna's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 070 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 070 records

Environmental DNA1 datasets · 2 countries34 detections

DNA & barcodingBOLD32 specimens

Genome at a glanceNCBI≈373 Mbp

01Narrative

Atrytonopsis hianna, the dusted skipper, is a butterfly of the family Hesperiidae. It is found in the United States from eastern Wyoming, central Colorado, northern New Mexico and central Texas east to New Hampshire and Massachusetts, south to peninsular Florida and the Gulf Coast. The wingspan is 32–43 mm. There is one generation with adults on from May to June in the north. In the south there are two generations with adults on wing from March to October in Florida. The larvae feed on Andropogon gerardi and Schizachyrium scoparium. Adults feed on the nectar from various flowers, including Japanese honeysuckle, wild strawberry, blackberry, wild hyacinth, phlox, vervain and red clover.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrytonopsis hianna has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections34

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

94Gmostly conserved

220Tmostly conserved

247Tmostly conserved

358Tmostly conserved

578Cmostly conserved

595Tmostly conserved

623Gmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes6

BIN1

Most divergent pair0.80%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atrytonopsis oviniasame genus4.0%Atrytonopsis pittacussame genus5.0%Atrytonopsis viereckisame genus5.5%Polites sabuletisame family6.3%Thespieus dalmansame family6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Atrytonopsis hianna carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈372 567 731 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Atrytonopsis hianna0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type2 070 records

Wild obs. + sensor1 307

Museum / vouchered711

Other52

Range

Area of Occupancy AOO3 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 334≤1 km 254≤10 km 199>10 km 233

1 020 georeferenced · 287 without coordinates

Open the mapobservation + sensor1 307

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 25≤1 km 75≤10 km 198>10 km 44

342 georeferenced · 369 without coordinates

Open the institutions mapphysical evidence711

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	250
New Haven, US	149
East Lansing, US	97
Cambridge, US	48
St. Paul, US	46
Toronto, CA	34
Royal Saskatchewan Museumlocation not on record	21
WSUClocation not on record	16
Cleveland Museum of Natural History, OH (CLEV)location not on record	14
Decorah, US	6
CUlocation not on record	5
UNHClocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
King Saud Universitylocation not on record	3
White River Junction, US	3
Natural History Museum of Utahlocation not on record	2
Chicago, US	1
UDlocation not on record	1
Blacksburg, US	1

19 institutions · 705 of 711 vouchered records shown · 6 without an institution code

09Environmental DNA34 detections

Where the DNA of Atrytonopsis hianna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 8.90–19.2

Seasonal swing summer↔winter20.6 °C

Max temp (day)20.0 °C 13.0–22.5

Min temp (night)12.9 °C 3.80–17.1

Precipitation82.3 mm/mo 55.5–95.3

Air humidity57.3 % 55.7–59.7

Moisture balance-60.3 mm/mo -81.8–1.40

Vapour deficit793 Pa 537–902

Wind speed5.70 m/s 3.70–6.20

Cloud cover41.1 % 38.6–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atrytonopsis hianna

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 070 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 070 records