Atrocalopteryx atrata

(Selys, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Calopterygidae/Atrocalopteryx

At a glance

Occurrence records1 647

Data sources9

Biological traits0

DNA specimens38

eDNA detections29

Sources9 archives

Databases and archives Atrocalopteryx atrata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 647 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 647 records

Environmental DNA1 datasets · 3 countries29 detections

DNA & barcodingBOLD38 specimens

Genome at a glanceGoaT · TreeOfSex2n = 26

01Narrative

Atrocalopteryx atrata is a species of damselfly belonging to the family Calopterygidae.World Odonata List It is native to Asia, where it is widespread in China, Korea, and Japan.Wilson, K. D. P. 2009. Calopteryx atrata. The IUCN Red List of Threatened Species. Downloaded on 20 January 2016. This species lives near rivers and streams in flatland habitat, open forests, and sometimes urban areas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrocalopteryx atrata has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes14

eDNA detections29

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P457 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

7Gmostly conserved

10Amostly conserved

22Gmostly conserved

25Cmostly conserved

43Amostly conserved

51Amostly conserved

68Cmostly conserved

71Tmostly conserved

136Amostly conserved

169Amostly conserved

220Tvariable

316Amostly conserved

324Tmostly conserved

412Gvariable

ATTAGTGCCATTAATATTAGGGGCCCCAGATATGGCTTTCCCACGATTAAATAACATAAGATTTTGACTATTACCTCCCGCGCTAACTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes6

BINs2

Most divergent pair8.3%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Matrona basilarissame family13.3%Matrona nigripectussame family13.5%Matrona cyanopterasame family13.6%Matrona japonicasame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS118S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027181 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Atrocalopteryx atrata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Chromosome records26–262n range26median26mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 263×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Kiauta B (1972) Synopsis of the main cytotaxonomic data in the order Odonata. Odonatologica 1: 73-102. ↗

2n 252×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type1 647 records

Wild obs. + sensor1 507

Museum / vouchered140

Range

Area of Occupancy AOO3 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 601≤1 km 80≤10 km 34>10 km 107

822 georeferenced · 685 without coordinates

Open the mapobservation + sensor1 507

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 140 records without

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	75
Kawasaki Shi Tama Ku, JP	48
Stockholm, SE	4
Iwate Prefectural Museumlocation not on record	3
Cornell University Insect Collectionlocation not on record	3
RCMlocation not on record	2
University Park, US	1

7 institutions · 136 of 140 vouchered records shown · 3 without an institution code

09Environmental DNA29 detections

Where the DNA of Atrocalopteryx atrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 4.90–22.3

Seasonal swing summer↔winter25.4 °C

Max temp (day)19.9 °C 9.20–27.3

Min temp (night)13.9 °C -0.8–16.8

Precipitation330 mm/mo 10.7–463

Air humidity64.9 % 48.4–66.5

Moisture balance218 mm/mo -47.5–325

Vapour deficit698 Pa 419–1,041

Wind speed2.50 m/s 2.20–4.00

Cloud cover44.2 % 23.6–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atrocalopteryx atrata

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 647 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 647 records