Atriplex watsonii

A.Nelson ex Abrams · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records490

Data sources11

Biological traits10

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Atriplex watsonii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility490 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF490 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · TreeOfSex2n = 36

01Narrative

Atriplex watsonii là loài thực vật có hoa thuộc họ Dền. Loài này được A.Nelson ex Abrams mô tả khoa học đầu tiên năm 1904.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub, Shrub

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: woody

Physiology & chemistry1

Photosynthetic pathwayC4

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex watsonii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM180340.1 ↗590 bp

ACGT

CGAAACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATTAACGGGGCCTGGGCGAAAGCCCGTTCCTCAAGCTAGGGCATCGCTTC …

Atriplex watsonii voucher s.n. internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Atriplex watsonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 183×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · TreeOfSex · plant

CCDB · ipcn-api-dl — NOBS, M. A. 1978. Chromosomal numbers in Atriplex. Carnegie Inst. Wash. Year Book 77: 240–241.

CCDB · book-ipcn75-78 — Nobs 1978

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type490 records

Wild obs. + sensor171

Museum / vouchered319

Origin

Native9

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 96≤1 km 11>10 km 4

111 georeferenced · 60 without coordinates

Open the mapobservation + sensor171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 83≤1 km 50≤10 km 34>10 km 3

170 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence319

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	126
Claremont, US	63
Riverside, US	22
US	20
Santa Barbara, US	18
Irvine, US	10
Mexico City, MX	8
San Luis Obispo, US	6
Arizona State University Biocollectionslocation not on record	5
Ensenada, MX	5
ASUlocation not on record	5
Moscow, US	4
Severin-McDaniel Insect Collectionlocation not on record	4
San Francisco, US	3
Mexico City, MX	3
Austin, US	3
Davis, US	2
Calabar, NG	2
Pomona Collegelocation not on record	1
Phoenix, US	1
The Huntington Library, Art Museum, and Botanical Gardenslocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
San Diego Natural History Museumlocation not on record	1
Arcata, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Los Angeles, US	1
Provo, US	1

28 institutions · 319 of 319 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Atriplex watsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Edge of salt marsh, near boardwalk. Associat…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 14.4–14.4

Seasonal swing summer↔winter7.20 °C

Max temp (day)16.2 °C

Min temp (night)12.8 °C

Precipitation21.9 mm/mo

Air humidity62.2 %

Moisture balance-99.7 mm/mo

Vapour deficit620 Pa

Wind speed3.30 m/s

Cloud cover31.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)